Osteoporosis International

http://link.springer.com/journal/198

List of Papers (Total 517)

Stimulation of intestinal calcium absorption by orally administrated vitamin D3 compounds: a prospective open-label randomized trial in osteoporosis

Summary Intestinal fractional calcium absorption (FCA) was assessed before and after vitamin D3 treatment. Serum 1,25(OH)2D concentration was significantly increased by plain vitamin D3 and reduced by eldecalcitol. The 1α hydroxyl calcidiol and eldecalcitol treatments increased FCA, which may be induced through direct stimulation of vitamin D receptors in the intestine. ...

Abaloparatide, a novel PTH receptor agonist, increased bone mass and strength in ovariectomized cynomolgus monkeys by increasing bone formation without increasing bone resorption

Summary Abaloparatide, a novel PTH1 receptor agonist, increased bone formation in osteopenic ovariectomized cynomolgus monkeys while increasing cortical and trabecular bone mass. Abaloparatide increased bone strength and maintained or enhanced bone mass-strength relationships, indicating preserved or improved bone quality. Introduction Abaloparatide is a selective PTH1R activator ...

Remarkable improvement in serum 25-hydroxyvitamin levels among hip fracture patients over a 12-year period: a prospective study in South-eastern Finland

Summary Hypovitaminosis D is a problem among hip fracture patients. In a 1-year cohort study comprising 245 hip fracture patients (mean age of females 81 years and males 78 years) from south-eastern Finland, the mean 25-hydroxyvitamin D [S-25(OH)D] concentration was 73(SD 31) nmol/L. Vitamin D supplementation has been integrated into our current practice. Introduction The ...

Spanish consensus on treat to target for osteoporosis

Summary To reach a Spanish expert consensus on a treat-to-target strategy in osteoporosis, a Delphi Consensus Study has been developed. Most of the experts (59.8%) were rheumatologist with a mean clinical experience of 21.3 years (SD 8.5). Consensus was achieved for 70% of the items. Therapeutic objectives, patient follow-up scheme, treatment failure criteria, and appropriate ...

Comorbidities and medication use in patients with a recent clinical fracture at the Fracture Liaison Service

Summary In this cross-sectional study, two-thirds of Fracture Liaison Service (FLS) patients had comorbidities and medications associated with increased bone- or fall-related fracture risk. Bone-related and fall-related fracture risk (BRR and FRR) were associated with age and fracture type, but not with gender or BMD. Systematic evaluation of these factors leads to a more profound ...

Abaloparatide-SC improves trabecular microarchitecture as assessed by trabecular bone score (TBS): a 24-week randomized clinical trial

Summary In a phase 2 trial of 222 postmenopausal women with osteoporosis aged 55 to 85 years randomized to one of three different doses of abaloparatide-SC, subcutaneous teriparatide, or placebo for 24 weeks, abaloparatide-SC resulted in improvements in skeletal microarchitecture as measured by the trabecular bone score. Introduction Subcutaneous abaloparatide (abaloparatide-SC) ...

Correction to: Characterization of trabecular bone microstructure in premenopausal women with distal radius fractures

Owing to an oversight by the corresponding author, the name of the third author of this article was rendered wrongly. His correct name is Kempland C. Walley.

Vertebral fractures and their association with health-related quality of life, back pain and physical function in older women

Summary Studies investigating prevalent vertebral fracture (VF) diagnosed using densitometry-based VF assessment (VFA) and associations with physical function, assessed by performance-based measures, are lacking. In this population-based study of 1027 older women, we found that prevalent VF, identified by VFA, was associated with inferior physical health, back pain and inferior ...

The impact of GI events on persistence and adherence to osteoporosis treatment: 3-, 6-, and 12-month findings in the MUSIC-OS study

Summary The goal of this multinational, prospective, observational study was to examine the relationship between gastrointestinal (GI) events and self-reported levels of medication adherence and persistence in postmenopausal women. A total of 73.9% of patients remained on their osteoporosis (OP) therapy at month 12, although the presence of a GI event at baseline, month 3, and ...

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing

In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

The effect of insulin on bone mineral density among women with type 2 diabetes: a SWAN Pharmacoepidemiology study

Summary This was a longitudinal study examining the effects of insulin use on bone mineral density loss. Insulin use was found to be associated with greater bone mineral density loss at the femoral neck among women with diabetes mellitus. Introduction Women with diabetes mellitus (DM) have higher bone mineral density (BMD) and experience slower BMD loss but have an increased risk ...

A case of regional migratory osteoporosis

We present the case of a middle-aged man with three episodes of regional migratory osteoporosis of the lower extremities occurring over a period of 8 years. Symptoms included a sudden onset of unilateral bone and joint pain. After initiation of pamidronate treatment, symptoms improved significantly. Regional migratory osteoporosis is a rare, but probably underdiagnosed condition ...

Reduced kidney function is associated with BMD, bone loss and markers of mineral homeostasis in older women: a 10-year longitudinal study

Summary Kidney function decreases with age; however, the long-term influence on bone density (BMD) in older women already at risk of osteoporosis is unknown. We followed kidney function and bone loss for 10 years. Declining kidney function was adversely associated with bone loss and mineral homeostasis in old women, though it attenuated with advanced aging. Introduction Existing ...

Global dietary calcium intake among adults: a systematic review

Low calcium intake may adversely affect bone health in adults. Recognizing the presence of low calcium intake is necessary to develop national strategies to optimize intake. To highlight regions where calcium intake should be improved, we systematically searched for the most representative national dietary calcium intake data in adults from the general population in all countries. ...

Low physical activity is related to clustering of risk factors for fracture—a 2-year prospective study in children

Summary The study investigates the effect of physical activity (PA) on a composite score for fracture risk in pre-pubertal children. Low PA in children is related to the composite score for fracture risk and the pre-pubertal years seem to be a period when PA positively affects the score. Introduction This study evaluates if PA in children is related to clustering of risk factors ...

Sedentary behaviour and bone health in children, adolescents and young adults: a systematic review–supplementary presentation

Background: Sedentary behaviour (SB) is a potential risk factor for suboptimal bone deposition in youth. Results: Total SB was negatively associated with lower extremity bone outcomes, while no association was observed with total body bone outcomes. Insufficient evidence was found for an association between total SB and lumbar spine bone outcomes. Conclusion: This review highlights ...