Osteoporosis International

http://link.springer.com/journal/198

List of Papers (Total 507)

Abaloparatide, a novel PTH receptor agonist, increased bone mass and strength in ovariectomized cynomolgus monkeys by increasing bone formation without increasing bone resorption

Summary Abaloparatide, a novel PTH1 receptor agonist, increased bone formation in osteopenic ovariectomized cynomolgus monkeys while increasing cortical and trabecular bone mass. Abaloparatide increased bone strength and maintained or enhanced bone mass-strength relationships, indicating preserved or improved bone quality. Introduction Abaloparatide is a selective PTH1R activator ...

Spanish consensus on treat to target for osteoporosis

Summary To reach a Spanish expert consensus on a treat-to-target strategy in osteoporosis, a Delphi Consensus Study has been developed. Most of the experts (59.8%) were rheumatologist with a mean clinical experience of 21.3 years (SD 8.5). Consensus was achieved for 70% of the items. Therapeutic objectives, patient follow-up scheme, treatment failure criteria, and appropriate ...

Comorbidities and medication use in patients with a recent clinical fracture at the Fracture Liaison Service

Summary In this cross-sectional study, two-thirds of Fracture Liaison Service (FLS) patients had comorbidities and medications associated with increased bone- or fall-related fracture risk. Bone-related and fall-related fracture risk (BRR and FRR) were associated with age and fracture type, but not with gender or BMD. Systematic evaluation of these factors leads to a more profound ...

Vertebral fractures and their association with health-related quality of life, back pain and physical function in older women

Summary Studies investigating prevalent vertebral fracture (VF) diagnosed using densitometry-based VF assessment (VFA) and associations with physical function, assessed by performance-based measures, are lacking. In this population-based study of 1027 older women, we found that prevalent VF, identified by VFA, was associated with inferior physical health, back pain and inferior ...

The impact of GI events on persistence and adherence to osteoporosis treatment: 3-, 6-, and 12-month findings in the MUSIC-OS study

Summary The goal of this multinational, prospective, observational study was to examine the relationship between gastrointestinal (GI) events and self-reported levels of medication adherence and persistence in postmenopausal women. A total of 73.9% of patients remained on their osteoporosis (OP) therapy at month 12, although the presence of a GI event at baseline, month 3, and ...

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing

In Table 2: Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC. Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT. In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

A case of regional migratory osteoporosis

We present the case of a middle-aged man with three episodes of regional migratory osteoporosis of the lower extremities occurring over a period of 8 years. Symptoms included a sudden onset of unilateral bone and joint pain. After initiation of pamidronate treatment, symptoms improved significantly. Regional migratory osteoporosis is a rare, but probably underdiagnosed condition ...

Reduced kidney function is associated with BMD, bone loss and markers of mineral homeostasis in older women: a 10-year longitudinal study

Summary Kidney function decreases with age; however, the long-term influence on bone density (BMD) in older women already at risk of osteoporosis is unknown. We followed kidney function and bone loss for 10 years. Declining kidney function was adversely associated with bone loss and mineral homeostasis in old women, though it attenuated with advanced aging. Introduction Existing ...

Global dietary calcium intake among adults: a systematic review

Low calcium intake may adversely affect bone health in adults. Recognizing the presence of low calcium intake is necessary to develop national strategies to optimize intake. To highlight regions where calcium intake should be improved, we systematically searched for the most representative national dietary calcium intake data in adults from the general population in all countries. ...

Low physical activity is related to clustering of risk factors for fracture—a 2-year prospective study in children

Summary The study investigates the effect of physical activity (PA) on a composite score for fracture risk in pre-pubertal children. Low PA in children is related to the composite score for fracture risk and the pre-pubertal years seem to be a period when PA positively affects the score. Introduction This study evaluates if PA in children is related to clustering of risk factors ...

Sedentary behaviour and bone health in children, adolescents and young adults: a systematic review–supplementary presentation

Background: Sedentary behaviour (SB) is a potential risk factor for suboptimal bone deposition in youth. Results: Total SB was negatively associated with lower extremity bone outcomes, while no association was observed with total body bone outcomes. Insufficient evidence was found for an association between total SB and lumbar spine bone outcomes. Conclusion: This review highlights ...

Increased levels of sodium chloride directly increase osteoclastic differentiation and resorption in mice and men

Summary To better understand the association between high salt intake and osteoporosis, we investigated the effect of sodium chloride (NaCl) on mice and human osteoclastogenesis. The results suggest a direct, activating role of NaCl supplementation on bone resorption. Introduction High NaCl intake is associated with increased urinary calcium elimination and parathyroid hormone ...

Value and potential limitations of vertebral fracture assessment (VFA) compared to conventional spine radiography: experience from a fracture liaison service (FLS) and a meta-analysis

Summary We evaluated the value of VFA in the identification of vertebral fractures using a retrospective study and a meta-analysis. Performance of VFA was adequate in the meta-analysis although this was not demonstrated in our centre. We recommend checking the performance of VFA tools before exclusively relying on this tool. Introduction Vertebral fractures are traditionally ...

Effect of vitamin D3 on bone turnover markers in critical illness: post hoc analysis from the VITdAL-ICU study

Summary In this post hoc analysis of the VITdAL-ICU study, an RCT in critically ill adults with 25-hydroxyvitamin D levels ≤20 ng/ml, vitamin D3 did not have a significant effect on β-Crosslaps and osteocalcin. Introduction Observational studies have shown accelerated bone loss in ICU survivors. A reversible contributor is vitamin D deficiency. In a post hoc analysis of the ...

PLS3 sequencing in childhood-onset primary osteoporosis identifies two novel disease-causing variants

Summary Altogether 95 children with primary bone fragility were screened for variants in PLS3, the gene underlying X-linked osteoporosis. Two children with multiple peripheral and spinal fractures and low BMD had novel disease-causing PLS3 variants. Children with milder phenotypes had no pathogenic variants. PLS3 screening is indicated in childhood-onset primary osteoporosis. ...

Effect of implementation of guidelines on assessment and diagnosis of vertebral fractures in patients older than 50 years with a recent non-vertebral fracture

Summary We evaluated the impact of a new Dutch guideline on systematic implementation of densitometric Vertebral Fracture Assessment (VFA) in patients with a recent non-vertebral fracture. Systematic implementation resulted in a significant increase of VFA, diagnosis of vertebral fractures (VFs), and percentage of patients eligible for treatment. Introduction VFs are underdiagnosed ...

Diversity in fall characteristics hampers effective prevention: the precipitants, the environment, the fall and the injury

Summary Falls among the elderly are common and characteristics may differ between injurious and non-injurious falls. Among 887 older Australian women followed for 1.6 years, 32% fell annually. Only 8.5% resulted in fracture and/or hospital admission. The characteristics of those falls are indistinguishable from those not coming to medical attention. Introduction The precipitants ...

Marginal structural model to evaluate the association between cumulative osteoporosis medication and infection using claims data

Summary Due to the suboptimal persistence to osteoporosis (OP) treatment, factors triggering treatment discontinuation/switching may be causing time-varying confounding. BP treatment was associated with the risk of overall infection in opposite directions in the unweighted Cox model versus the weighted MSM. The discrepancy of effect estimates for overall infection in the MSM ...