Impaired skeletal formation in mice overexpressing DMP1

Orthopedic Research and Reviews impaired skeletal formation in mice overexpressing DMP1 0 Brodie Tooth Development g enetics and Regenerative Medicine Research Laboratory, University of illinois , c hicago, iL , Us A Dentin matrix protein 1 (DMP1) is a noncollagenous protein expressed in mineralized tissues such as bone, dentin, and cartilage. To investigate the role of DMP1 during bone formation, transgenic mice overexpressing DMP1 under the control of the CMV promoter were generated. These mice displayed an increased mineralization phenotype in bone. In addition, accelerated terminal differentiation of the epiphyseal growth plate chondrocytes were also observed. To investigate the potential role of DMP1 in osteoblast differentiation, bone marrow stem cells were stimulated with DMP1 and assayed for “early” and “late” markers for osteoblast differentiation. DMP1 treatment increased the expression of CBFA1, BMP2, COL1, and OCN within two days. An in vitro mineralized nodule formation assay demonstrated that the bone marrow stem cells could differentiate and form a mineralized matrix in the presence of DMP1. Together, these results support a model whereby DMP1 functions as a key regulatory molecule that is required for normal growth and development of bone and cartilage. Michael Albazzaz; Karthikeyan n arayanan; Jianjun h ao; Roma Andheri; Amsaveni Ramachandran s riram Ravindran; Anne g eorge - The first evidence for a functional role for DMP1 in mineralization, resulted from in vitro studies, wherein DMP1 was shown to nucleate hydroxyapatite.7,11 However, DMP1-null mice showed no apparent skeletal or tooth phenotype during early development, suggesting functional redundancy due to overlapping expression with 8 other noncollagenous proteins like BAG-75. Feng and -210 colleagues have demonstrated that DMP1-null mice have l-Ju defective osteocyte maturation, leading to pathological 3n1 changes in bone mineralization and defects in cartilage 21o formation.12–14 .195 In the present study, we examined the biological function ..23 of DMP1 in vivo by generating a transgenic (TG) mouse 132 overexpressing DMP1. A cytomegalovirus (CMV) pro/yb moter was used as it is reputed to be one of the strongest .com and contains most promiscuous regulatory elements for rsse directing high transgene expression.15,16 In this study, we p sought to characterize the skeletal phenotype of the TG mice .vdoewww l.ysneou overexpressing DMP1. /:/s la Materials and methods ttp on h rs DnA constructs from rpeo The CMV–DMP1 plasmid was generated by first polymerase daed F chain reaction (PCR) amplifying the rat DMP1 cDNA with lno the coding region and 3´ untranslated region. This fragment odw was then cloned into KpnI and XhoI sites of the pcDNA isew 3.1+ vector (Invitrogen, Carlsbad, CA, USA) and digested veR with Bgl II and Pvu II to release the cassette containing the dna CMV–DMP1 and bovine growth hormone poly A transgene. rch The released DNA fragment (transgene) was microinjected seae into mouse blastocysts. R c i d e p o h tr O generation and genotyping of Tg mice Microinjections into CD-1 (Charles River Laboratories, Wilmington, MA, USA) outbred mice were performed at the University of Illinois at Chicago Transgenic Facility under institutionally approved protocols. The F0 DMP1-positive lines were identified by isolating genomic DNA from tail fragments using DNeasy tissue kit (Qiagen, Valenica, CA, USA). PCR was carried out with CMV-specific primers. Briefly, 100 ng of genomic DNA was used in the PCR reaction with 35 cycles of 94 °C for 30 sec, 56 °C for 30 sec, and 72 °C for 30 sec. Genotyping was carried using the following specific primers for CMV promoter. CMV Forward 5´--- GTTCATAGCCCATATATGGAGTTCCGCG --- 3´ CMV Reverse 5´ ----- GACCTCCCACCGTACACGCCTAC ----- 3´. submit your manuscript | www.dovepress.com Dovepress Southern blot analysis was also performed to confirm the presence of DMP1 transgene. Western blot analysis Total protein from liver, muscle, and heart tissue samples were extracted with T-PER lysis buffer (Pierce Biotechnology, Rockford, IL, USA). Briefly, 0.1 g of fresh tissue from new born animals were homogenized in 2 ml of T-PER lysis buffer and centrifuged at 15,000 × g for 15 min and the supernatant collected. Western blot analysis was performed with affinity-purified DMP1 antibody. Total protein from the bone tissue was isolated by homogenizing the femurs from three-day-old animals in the presence of liquid nitrogen and extracted with 0.5 M EDTA (ethylenediaminetetraacetic acid) at pH 7.5 in the presence of a protease inhibitor mixture. histological analysis The hind limb and the mandibles were dissected out from the TGs (n = 5) and the wild type (WT; n = 5) at four weeks of age. The tissues were decalcified and embedded in paraffin. Sections were cut at 5 µm thickness and treated with various histological stains. Hematoxylin and eosin (H&E) stain was used for outlining the general tissue architecture (...truncated)