A PDF file should load here. If you do not see its contents
the file may be temporarily unavailable at the journal website
or you do not have a PDF plug-in installed and enabled in your browser.
Alternatively, you can download the file locally and open with any standalone PDF reader:
https://nar.oxfordjournals.org/content/42/16/10832.full.pdf
A competitive formation of DNA:RNA hybrid G-quadruplex is responsible to the mitochondrial transcription termination at the DNA replication priming site
Ke-wei Zheng
0
Ren-yi Wu
0
Yi-de He
0
Shan Xiao
0
Jia-yu Zhang
0
Jia-quan Liu
0
Yu-hua Hao
0
Zheng Tan
0
0
State Key Laboratory of Biomembrane and Membrane Biotechnology, Institute of Zoology, Chinese Academy of Sciences
,
Beijing 100101, P.R. China
Human mitochondrial DNA contains a distinctive guanine-rich motif denoted conserved sequence block II (CSB II) that stops RNA transcription, producing prematurely terminated transcripts to prime mitochondrial DNA replication. Recently, we reported a general phenomenon that DNA:RNA hybrid Gquadruplexes (HQs) readily form during transcription when the non-template DNA strand is guaninerich and such HQs in turn regulate transcription. In this work, we show that transcription of mitochondrial DNA leads to the formation of a stable HQ or alternatively an unstable intramolecular DNA Gquadruplex (DQ) at the CSB II. The HQ is the dominant species and contributes to the majority of the premature transcription termination. Manipulating the stability of the DQ has little effect on the termination even in the absence of HQ; however, abolishing the formation of HQs by preventing the participation of either DNA or RNA abolishes the vast majority of the termination. These results demonstrate that the type of G-quadruplexes (HQ or DQ) is a crucial determinant in directing the transcription termination at the CSB II and suggest a potential functionality of the co-transcriptionally formed HQ in DNA replication initiation. They also suggest that the competition/conversion between an HQ and a DQ may regulate the function of a G-quadruplex-forming sequence.
-
Mitochondria are cytoplasmic organelles within
eukaryotic cells that carry their own genomic materials apart
from those in the nucleus. Human mitochondrial DNA
(mtDNA) codes 37 genes in a double-stranded closed
circular molecule of 16.5 kb. It contains a distinctive
guaninerich (G-rich) motif (GGGGGAGGGGGGGTTTG)
denoted conserved sequence block II (CSB II) that directs
premature termination of transcription (1). The
prematurely terminated transcript serves as a primer to initiate
mtDNA replication (1,2). The transition from
transcription to primer formation was once proposed by the cleavage
of RNA transcript by the mitochondrial RNA processing
(RNase MRP) endonuclease (3,4). However, this model is
challenged by the fact that the majority of the RNase MRP
is localized to the nucleolus (5). The termination is
irrespective of the type of RNA polymerase involved and occurs
in transcriptions with the mitochondrial RNA polymerase
and cofactors or T7 RNA polymerase (68). This fact
suggests that the transcription termination is primarily
determined by the sequence or structural feature of the CSB II
(1).
A recent work suggested that the premature
termination of transcription at the CSB II is stimulated by
G-quadruplex structures formed in RNA transcript (6).
G-quadruplexes are four-stranded structures formed by
G-rich nucleic acids, in which four G-tracts are held
together by Hoogsteen hydrogen bonds in a multi-layered
stack of G-quartets (911). G-quadruplex formation
is stabilized by K+ and Na+, but not by Li+ (12), and
involves the 7-nitrogen (N7) in four of the eight
Hoogsteen hydrogen bonds in a G-quartet (13). In that work,
it was found that transcription using 7-deaza-GTP in
place of the normal guanosine triphosphate (GTP) to
inhibit RNA from forming G-quadruplex dramatically
reduced the CSB II-dependent transcription
termination. The termination was more efficient in K+ than in
Li+ solution. Single or double GA mutation in the
G5AG7 core of the CSB II reduced the termination,
but those outside of the G5AG7 did not. All these facts
are suggestive of an involvement of G-quadruplex
structures that required the participation of RNA
within the G5AG7 tract. A 30-nt RNA oligonucleotide
(GAAGCGGGGGAGGGGGGGUUUGGUGGAAAU)
covering the CSB II plus the 5 nt upstream and 12 nt
downstream of the CSB II formed intramolecular RNA
G-quadruplex in an overnight incubation in a K+ or
Na+ solution as examined by native gel electrophoresis.
It was thus concluded that a predominant unimolecular
G-quadruplex uni-G4 whose formation requires guanines
within CSB II was the most important quadruplex species
to mediate the transcription pretermination (6).
One key question remaining unaddressed in that work is
that whether the G-quadruplex seen in the incubation
actually forms in transcription, which is important for
establishing a definitive connection between the structure and the
transcription termination. Recently, we found that DNA
bearing two or more G-tracts on the non-template strand
readily forms DNA:RNA hybrid G-quadruplex (HQ)
structures in transcription by recruiting G-tracts from both the
non-template DNA strand and RNA transcript. This is a
general phenomenon instead of being characteristic of
specific sequences. Such HQs can in turn modulate gene
expression under both in vitro and in vivo conditions (14). We
further showed that putative (...truncated)