Unique X-linked familial FSGS with co-segregating heart block disorder is associated with a mutation in the NXF5 gene

Human Molecular Genetics, Sep 2013

Focal segmental glomerulosclerosis (FSGS) is the consequence of a disease process that attacks the kidney's filtering system, causing serious scarring. More than half of FSGS patients develop chronic kidney failure within 10 years, ultimately requiring dialysis or renal transplantation. There are currently several genes known to cause the hereditary forms of FSGS (ACTN4, TRPC6, CD2AP, INF2, MYO1E and NPHS2). This study involves a large, unique, multigenerational Australian pedigree in which FSGS co-segregates with progressive heart block with apparent X-linked recessive inheritance. Through a classical combined approach of linkage and haplotype analysis, we identified a 21.19 cM interval implicated on the X chromosome. We then used a whole exome sequencing approach to identify two mutated genes, NXF5 and ALG13, which are located within this linkage interval. The two mutations NXF5-R113W and ALG13-T141L segregated perfectly with the disease phenotype in the pedigree and were not found in a large healthy control cohort. Analysis using bioinformatics tools predicted the R113W mutation in the NXF5 gene to be deleterious and cellular studies support a role in the stability and localization of the protein suggesting a causative role of this mutation in these co-morbid disorders. Further studies are now required to determine the functional consequence of these novel mutations to development of FSGS and heart block in this pedigree and to determine whether these mutations have implications for more common forms of these diseases in the general population.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

http://hmg.oxfordjournals.org/content/22/18/3654.full.pdf

Unique X-linked familial FSGS with co-segregating heart block disorder is associated with a mutation in the NXF5 gene

Human Molecular Genetics Unique X-linked familial FSGS with co-segregating heart block disorder is associated with a mutation in the NXF5 gene Teresa Esposito 2 Rod A. Lea 1 Bridget H. Maher 1 Dianne Moses 1 Hannah C. Cox 1 Sara Magliocca 2 Andrea Angius 0 Dale R. Nyholt 6 Thomas Titus 5 Troy Kay 5 Nicholas A. Gray 4 Maria P. Rastaldi 3 Alan Parnham 5 Fernando Gianfrancesco 2 Lyn R. Griffiths 1 0 Institute of Genetic and Biomedical Research, National Research Council of Italy , Cagliari , Italy 1 Genomics Research Centre, Griffith Health Institute, Griffith University , Gold Coast, QLD 4222 , Australia 2 Institute of Genetics and Biophysics 'Adriano Buzzati-Traverso', National Research Council of Italy , Naples , Italy 3 Renal Research Laboratory, Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico & Fondazione D'Amico per la Ricerca sulle Malattie Renali , Milano , Italy 4 Renal Services, Nambour Hospital , Nambour, QLD , Australia 5 Renal Department, Gold Coast Hospital , QLD , Australia 6 Queensland Institute of Medical Research , Herston Road, Herston, Brisbane 4006 , Australia Focal segmental glomerulosclerosis (FSGS) is the consequence of a disease process that attacks the kidney's filtering system, causing serious scarring. More than half of FSGS patients develop chronic kidney failure within 10 years, ultimately requiring dialysis or renal transplantation. There are currently several genes known to cause the hereditary forms of FSGS (ACTN4, TRPC6, CD2AP, INF2, MYO1E and NPHS2). This study involves a large, unique, multigenerational Australian pedigree in which FSGS co-segregates with progressive heart block with apparent X-linked recessive inheritance. Through a classical combined approach of linkage and haplotype analysis, we identified a 21.19 cM interval implicated on the X chromosome. We then used a whole exome sequencing approach to identify two mutated genes, NXF5 and ALG13, which are located within this linkage interval. The two mutations NXF5-R113W and ALG13-T141L segregated perfectly with the disease phenotype in the pedigree and were not found in a large healthy control cohort. Analysis using bioinformatics tools predicted the R113W mutation in the NXF5 gene to be deleterious and cellular studies support a role in the stability and localization of the protein suggesting a causative role of this mutation in these co-morbid disorders. Further studies are now required to determine the functional consequence of these novel mutations to development of FSGS and heart block in this pedigree and to determine whether these mutations have implications for more common forms of these diseases in the general population. - INTRODUCTION Focal segmental glomerulosclerosis (FSGS) is a disease affecting the glomerular podocyte where the pathology is focal (not all glomeruli are involved), segmental (only part of a glomerulus is involved) with the presence of sclerosis of the glomerular capillary tuft that become more widespread with disease progression. It is clinically characterized by proteinuria and a progressive decline in renal function, eventually requiring renal replacement therapy (1 – 6). Onset may be congenital, usually in childhood, or may present in adulthood. FSGS accounts for 35% of all cases of idiopathic nephrotic syndrome and represents ∗To whom correspondence should be addressed at: Genomics Research Centre, Griffith Health Institute, Griffith University, QLD 4222, Australia. Tel: +61 755528664; Fax: +61 755529081; Email: †The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. ‡The authors wish it to be known that, in their opinion, the final two authors should be regarded as joint Senior Authors. a final common pathway for a variety of other renal and systemic diseases (e.g. diabetic nephropathy) (1,3,5). Familial forms of FSGS are linked to a number of genetic loci (Supplementary Material, Table S1). Mutations in some of these genes, for example NPHS1 and NPHS2, are also found in sporadic cases of FSGS (7). Many of the FSGS mutations have also been associated with syndromes involving non-renal tissues, for example nail-patella syndrome and Denys-Drash/ Frasier syndrome. Genetic variation at the MYH9/APOL1 locus, which encodes the non-muscle myosin heavy chain and apoprotein L-1 (chromosome 22), has also been associated with an increased risk of hypertension and FSGS in AfricanAmericans, but is not associated with familial FSGS (8 – 11). The mutated genes in the familial forms of FSGS encode podocyte proteins involved in the maintenance of glomerular slit diaphragms, which in turn, are responsible for holding back macromolecular structures like proteins within the vascular bed. The affected proteins include nephrin (NPHS1), a cation channel (TRPC6), a-actinin 4 (ACTN4), podocin (NPHS2), formin (INF2), an adaptor protein (CD2AP), a non-muscle class I myosin (Myo1E), a RhoA-activated Rac1 GTPase-activating protein (ARHGAP24) and a phospholipase C (PLCE1) (12 – 20) (Supplementary Material, Table S1). Some of the genes identified for familial cases of non-syndromal FSGS may also be important in the more common, so-called, ‘sporadic’ versions of the disease (7 – 10). To date, there are no reports in the literature of FSGS linkage to the X chromosome. We have identified a large Australian pedigree with FSGS and associated heart block which tends to transmit these two diseases in an X-linked recessive manner. FSGS and co-morbid heart block have not been previously observed for familial FSGS and there is no clinical or histological evidence of Fabry disease in this family. To date, three genetic loci have been associated with progressive familial heart block (PFHB1A, PFHB1B and PFHB2) located on chromosomes 3p21, 19q13.2 – q13.3 and 1q32.2 – q32.3, respectively. Mutations causing cardiac conduction defects were found in the genes SCN5A (PFHB1A) SCN1B and TRPM4 (PFHB1B); however, no association with FSGS has been described at these loci (13,21 – 23). We hypothesize that a novel mutation(s) in a gene(s) residing on the X chromosome is responsible for causing FSGS and comorbid heart block in this affected pedigree. Here, we provide a full description of this new phenotype and describe a combined approach of linkage and whole exome sequencing to identify the genetic mutation associated with these co-segregating diseases in this Australian pedigree. Clinical characteristics of FSGS pedigree The pedigree (Supplementary Material, Fig. S1) came to our attention in 1998 after consultation with the proband (V:5(ID75)), who was diagnosed to have FSGS at the age of 32. At the age of 42, he developed complete heart block and required permanent pacemaker insertion. He was noted to be hypertensive at the age of 48 in the context of a family history of hypertension. Repeat renal biopsy at the age of 48 showed global sclerosis in 3/10 glomeruli. A further 3/10 glomeruli showed segmental sclerosing lesions (Fig. 1). There was moderate tubular atrophy and interstitial fibrosis and a mild lymphocytic interstitial infiltrate. The interlobular arteries showed moderate arteriosclerosis. Immunofluorescence showed finely granular IgA deposition in the mesangium. Electron microscopy confirmed frequent small mesangial immune deposits. Renal function deteriorated and he started peritoneal dialysis at age 56. An echocardiogram at age 57 was reported showing mild concentric hypertrophy and a coronary angiogram was unremarkable. He was diagnosed with prostatic carcinoma at age 57 and obstructive sleep apnoea consequent to obesity at the age of 59. He is currently maintained on haemodialysis. In the six generations starting from the mid-1800s, with the migration of a male from Britain, early death was a curse that followed the males of this family. A total of 12 males are known to have developed progressive decline in renal function. The causes of premature death in three males (ID1, ID8 and ID12) from three earlier generations who died in their second to fourth decade cannot be confirmed; however, family histories suggest renal failure. Four of the affected males in more recent generations have died, one after pacemaker failure (IV:19(ID50)) and one 5 years after renal transplant (IV:26(ID62)). Two others had presumed renal failure (III:5(ID14) and III:7(ID16)) and one of these also had heart block (III:5(ID14)) (history from family, death certificate or medical records). A histological diagnosis of the renal pathology is unavailable for these four affected males as they died prior to the development of renal biopsy as a routine clinical investigation in the regions they were residing. At present, there are five living males (V:1(ID69), V:5(ID75), V:14(ID85), V:24(ID105), VI:7(ID136)) with FSGS. Biopsy FSGS or renal Cardiac conduction failure disorder RF, renal failure; KT, kidney transplant; FSGS, confirmed by biopsy; P, proteinuria; U, unknown; PM, pacemaker; HB, progressive heart block. data were available for three of the five living individuals for this study (V:1(ID69), V:5(ID75) and VI:7(ID136)). At least six males suffering from kidney failure are also known to have developed progressive cardiac conduction disorder (ID14, ID16, ID50, ID69, ID75 and ID85) which started with first degree heart block and eventually led to complete heart block. Three of these individuals are deceased and the surviving three have pacemakers. The two remaining individuals diagnosed with FSGS (ID105 and ID136) have not shown symptoms of heart block to date; however, these individuals are the youngest affected males and may therefore still present with this comorbidity. An additional living male (V:30(ID113)) presented with firstdegree heart block and mild proteinuria at 20 years of age. This individual may either have a less severe phenotype or may be destined to proceed to the full syndrome with advancing age. The male-only presentation of FSGS traits and associated cardiac conduction disorder implies that an X-linked recessive mode of transmission is acting in this pedigree. A summary of clinical characteristics of affected males is shown in Table 1. While female relatives are unaffected for the combined phenotypes of progressive FSGS and cardiac conduction disease, other potentially related clinical disorders have been observed in females of this pedigree. Two daughters (IV:7(ID34), IV:16(ID47)) of affected males have had proteinuria with mild histological evidence of FSGS on renal biopsy, but have not developed progressive renal disease by their sixth decade. An additional two females (IV:23(ID55) and V:8(ID78)) have had proteinuria and haematuria for three decades without deterioration of renal function. Furthermore, pre-eclampsia has been reported in 10 women (IV:7(ID34), IV:16(ID47), IV:23 (ID55), IV:24(ID59), V:10(ID80), V:11(ID82), V:13(ID84), V:16(ID88), VI:9(ID139), VI:12(ID142)), including the two presenting with mild non-progressive FSGS, with no residual loss of renal function. Other conditions noted in this family include clear cell renal carcinoma in a male, transitional cell carcinoma of the renal pelvis in a female who is a putative obligate carrier under the X-linked model (she also has an affected son), a malignant renal tumour in a young female and a renal ‘cyst’ in a putative carrier who had mild FSGS on renal biopsy in her third decade. A summary of the clinical phenotypes observed in living relatives are detailed in Supplementary Material, Table S2. This family appears to be unique. There have been no reports of any pedigree co-inheriting FSGS and progressive cardiac conduction disorder, nor have renal tumours been associated with either condition, other than a known increased risk of renal malignancy in patients with established renal failure. Moreover, there has not been a previous report of FSGS or associated disease being transmitted in an X-linked fashion. Linkage analysis Only males exhibit the full form of both FSGS and progressive heart block in this large multigenerational pedigree. The transmission pattern is suggestive of an X-linked mode of inheritance. To test this hypothesis, linkage analysis was performed using a high density (3.8 cM) X-chromosomal scan. To prevent model misspecification, non-parametric linkage methods were employed. Two linkage scans were performed using subtly different phenotypic models. The results of multipoint linkage analysis are detailed in Figure 2A. The first model included only those males who exhibited complete FSGS (Model 1). Significant evidence of linkage was detected at Xq markers, with a maximum LOD score of 2.72 (P ¼ 2 × 1024) observed at marker DXS1106. When the male individual presenting with a milder phenotype was included as affected (Model 2), the peak linkage signal at marker DXS1106 increased to a LOD score of 3.32 (P ¼ 5 × 1025). The upper and lower limits of the 95% confidence interval were at 118 and 100 cM, respectively. This result suggests the disease gene(s) must reside between markers DXS8077 and DXS8064, encompassing a 21.19 cM interval spanning Xq21.33 to Xq24. Co-segregation of the FSGS phenotype with the Xq haplotype is depicted in Figure 2B. A predisposing haplotype has been inherited in all affected individuals. One unaffected individual (VI:2(ID137) also shares the predisposing haplotype. Subsequent to this analysis, clinical information has become available showing that proteinuria has developed in this individual. Recombination events in four affected individuals (IV:13(ID50), V:1(ID69), V:2(ID75) and V:12(ID113)) reveal a shared disease haplotype comprised of five markers, spanning Xq22.1 – 23. In order to exclude linkage of autosomal loci to the phenotypes under investigation, 20 individuals (6 men from the youngest generations, with 3 affected and 3 unaffected, and 14 females, including 11 obligate carriers and 3 unaffected) from the Australian pedigree were genotyped using the Affymetrix GenomeWide Human SNP Array 6.0. While known FSGS-associated genes have been previously sequenced in this family, this approach enabled exclusion of potentially causative insertions and deletions in these genes. Furthermore, this approach confirmed the X-chromosome disease locus at the region between markers rs394127 and rs10521569, spanning a genomic region of 16 Mb. This genomic region houses 145 genes (Supplementary Material, Fig. S2) including interesting candidates that are reported in Supplementary Material, Table S3. Recently, the phenylalanine at codon 222 of the COL4A5 gene located within this linkage interval was found mutated in a family showing X-linked glomerulopathy (24). Direct sequencing of all coding regions, including exon – intron boundaries, of the COL4A5 gene (and other candidates listed in Supplementary Material, Table S3) did not identify any mutations in affected members of the pedigree, therefore excluding these genes as causative. FSGS gene identification strategy We performed whole-exome sequencing of two affected males from the Australian FSGS pedigree (ID69, and ID85). We adopted a prioritization scheme, well detailed in Table 2 to identify the pathogenic mutation in each individual, similar to the approach taken by other recent studies (25 – 27). In a first step, we performed a thorough survey of all previously identified FSGS genes in order to definitively exclude their involvement in the disease phenotype. After filtering (Table 2), we matched data from both individuals to obtain shared variants. Eighty autosomal non-synonymous coding variants were shared between the two samples. Only 40 of these variants were not found in the 1000 Genomes database and were confirmed by direct sequencing in the two patient samples. None of the autosomal variants showed complete segregation with the disease in our family, adding support to the X-linked inheritance of the disease as demonstrated by linkage analysis (Table 2). Assuming that FSGS segregates as an X-linked disorder in our family, we focused on X-linked hemizygous variants that were not registered in dbSNPs or were not identified in our six in-house exomes. We surveyed all genes of the X chromosome in each individual with particular attention on the 20 Mb region detected by linkage analysis (see Fig. 2A and Supplementary Material, Fig. S2). We obtained coverage of more than 40× for almost all exons, including exon – intron boundary and 5′ and 3′ untranslated regions (Supplementary Material, Fig. S3). However, we found that the first exons in 12 different genes located in the linkage interval were not covered by a suitable number of sequences. To ensure that these regions were fully interrogated, we also analysed by direct Sanger sequencing to exclude the presence of variants in these exons. This sequencing approach identified four X-linked candidate gene mutations for ID69 and six X-linked candidate gene mutations for ID85. ID69 + ID85 SNV: single nucleotide variation; ∗Non-synonymous variants obtained after to filter with six in house genome (one healthy individual and five individuals with unrelated diseases); Aut + 1000 genomes ¼ autosomal variants remaining after filtering with 1000 genome database; Aut + segregation ¼ Autosomal variants remaining after segregation analysis in FSGS family; X + segregation ¼ X variants remaining after segregation analysis; X + segr. + delet ¼ X variants remaining after segregation analysis and after analysis of deleterious effect of the change with SIFT and Polyphen 2. Among them, only mutations in two candidate genes, the Nuclear RNA Export Factor 5 (NXF5) gene and the AsparagineLinked Glycosylation 13 (ALG13) gene, were common in the two individuals and were located in the linkage candidate region (Table 2). The inheritance of the R113W variant in the NXF5 gene and the T141L/ N121I variant in the ALG13 gene (T141L, isoform 2 NM_018466 and N121I isoform 3 NM_001039210) were examined by Sanger sequencing in DNA of 56 individuals of the family. This analysis confirmed that both variants segregated with the disease phenotype in the pedigree. We then checked these variants in the 1000 Genome database, and did not find any observations of them. In addition, we analysed 598 chromosomes from unrelated healthy controls from the same geographical origin. Both the R113W variant of the NXF5 gene and the T141L/N121I variant in the ALG13 gene were absent in this cohort, suggesting a role of either of these variants in the complex phenotype observed in this family. We then checked the linkage interval between the two candidate genes (NXF5 and ALG13) for SNP alleles that were not shared between the two affected samples. Approximately 1000 SNPs were tested between the two genes using an Affymetrix chip assay and a deep sequencing approach; for these SNPs, all alleles were shared between the two affected samples, providing evidence of a single haplotype spanning these two genes in the pedigree. Nuclear RNA export factor 5 (NXF5) gene Mutation analysis confirmed that the c.337C.T change in exon 7 of the NXF5 gene causes the R113W amino acid change (Fig. 3A). Most variants underlying rare Mendelian diseases either affect highly conserved sequences and/or are predicted to be deleterious. For this reason, we analysed the R113W variant with SIFT, PolyPhen2, PMut and Align GVGD software (http://sift.bii.a-star.edu.sg/www/SIFT_seq_submit2. html, http://genetics.bwh.harvard.edu/pph2/, http://mmb2.pcb. ub.es:8080/PMut/; http://agvgd.iarc.fr/agvgd_input.php) to confirm a deleterious effect of this variant. At this position (R113), only arginine (R), lysine (K) or glutamine (Q) is tolerated (Supplementary Material, Fig. S4). PolyPhen-2, PMut and Align GVGD analysis supported the notion that this variant is ‘damaging’ with a probability score of 0.67 (PolyPhen2) and prediction Class C65 (GV: 0,00; GD: 101,29 Align GVGD). Three transcripts (ENST00000473265, ENST00000361708 and ENST00000537026) are described in the Ensembl genome browser (http://www.ensembl.org) for the human NXF5 gene, so to perform the expression profiling of these three transcripts of the NXF5 gene, we designed four sets of primers specific for each isoform. The expression profile was analysed using a panel of adult human tissues using a real-time PCR assay. A different expression profile was observed for the different isoforms; significant expression was detected in the brain, pancreas, kidney, testes, ovary and lung. A low expression level was detected in heart and no expression was detected in muscle (Fig. 3B). No difference of expression of the NXF5 gene was observed in cDNA samples derived from patients blood (Fig. 3C). Direct sequencing of the PCR fragments showed that the mutated allele is expressed also in female carriers, suggesting that there is not skewed X inactivation (Fig. 3C). These data could explain the mild phenotype that we observed in female carriers. To assess the expression of this gene in podocytes, an assay was designed to detect the Nxf7 gene (the mouse homologue of NXF5) using RNA obtained from mouse podocytes as human podocyte tissue was unavailable. Comparable levels of expression were observed for all tissues examined (Fig. 3D). The NXF5 gene belongs to the NXF gene family which, in humans, also includes the NXF1 located on chromosome 11, as well as NXF2 and NXF3 genes clustered on Xq22.1. Evolutionary conservation analysis shows high similarity for these proteins. NXF3 seems to be the most ancient gene and, together with NXF1 and NXF2, is conserved in all mammals (Fig. 3E). Nxf7 is present only in mice and rats and was lost in primates, and NXF5 is a recently acquired gene present only in chimpanzees and humans. Some authors propose that the human NXF5 gene is the analogue of the mouse Nxf7 gene (28). Interestingly, the R113W amino acid change is conserved in all genes and all species except the NXF3 gene, in which the arginine (R) is replaced with glutamine (Q) (Fig. 3E). However, glutamine is one of the three amino acids that SIFT predicts to be tolerated in this protein position. To assess if the NXF5-R113W mutation affects the stability and/or the subcellular localization of the protein, Human embryonic kidney (HEK)-293 and Human kidney-2 (HK-2) human cell lines were transiently transfected with wt or mutant constructs (pcDNA3.1-NXF5-R113-HIS; pcDNA3.1-NXF5-W113-HIS; pEGFP-NXF5-C1-113R; pEGFP-NXF5-C1-113W). The GFP constructs gave a non-specific pattern of expression resembling the empty pGFP-C1 vector, suggesting that this protein could be modified by digestion. Preliminary data suggest that the Histagged NXF5 wt (113R) protein is localized in the nucleus and in the cytoplasm, including in the cellular processes and shows a higher level of expression than the mutated protein. The NXF5-113W protein localized mainly at the level of the nuclear membrane, suggesting that this mutation could affect the stability and the localization of the protein (Fig. 4A and B). Rhodamine phalloidin treatment of the cells, which stains the F-actin filaments, did not show differences in actin organization when the cells were transfected with wt or mutant proteins (Fig. 4A). Asparagine-linked glycosylation 13 (ALG13) gene In Ensembl, at least six transcripts of the ALG13 gene are reported to be protein coding. The AC/TT nucleotide change identified in the examined family is located in an intronic region in isoform 1 (long isoform). In isoform 2 (NM_018466), the AC/TT variant is located in exon 6 at position 421 – 422 and causes the amino acid change T141L, while in isoform 3 (NM_001039210), the AC/TT variant is located in exon 6 at position 362 – 363 and causes the amino acid change N121I. Mutation analysis confirmed the segregation of this variant in all affected members of the FSGS family (Fig. 5A). The missense change affects highly evolutionarily conserved residues of ALG13 (Fig. 5B); however, SIFT software predicted a tolerated effect for the T141L ALG13 variant, but the software was not able to predict any effect for the N121I variant. Polyphen-2 and PMut analyses supported this by showing a very low probability of a damaging effect at this variant (P , 0.05). However, the Align GVGD software predicts a damaging effect of the ALG13-T141L variant (GV:0.00; GD: 92.35; Class C65). To perform expression profiling of the ALG13 gene, we analysed a panel of adult human tissues using a real-time PCR assay designed to specifically amplify the three ALG13 isoforms. All isoforms were highly expressed in the ovary, kidney, pancreas, brain, testes, lung and heart. The short isoforms 2 and 3 were also highly expressed in liver, and low expression levels were detected in muscle (Fig. 5C). No difference of expression was observed for both isoforms in cDNA samples derived from patients’ blood (Fig. 5D). Podocyte expression was performed using RNAs from mouse tissue. Alg13 showed highest expression in the mouse podocyte from the panel (Fig. 5E). To assess any functional effect of the ALG13-T141L mutation, human HEK-293 and HK-2 cell lines were transiently transfected with wt or mutant constructs. Preliminary data do not show any difference between wt and mutant proteins in the level of expression and cytoplasm subcellular localization, suggesting that this mutation does not impair the stability or the localization of the protein and does not affect actin organization within the cell (data not shown). Overall, the complete absence of the R113W mutation in the NXF5 gene in the healthy control cohort coupled with the in silico prediction of a deleterious effect provides strong evidence that the R113W mutation in the NXF5 gene could be the causative disease mutation. In addition, however, the T141L/N121I mutation in the ALG13 gene cannot be ruled out completely despite three in silico predictions (SIFT PMut and PolyPhen2) that this mutation has a low probability of causing a damaging effect. Consequently, this mutation may also contribute a small effect on disease phenotype. FSGS, one of the most common glomerulopathies, is typically marked by massive proteinuria and often associated with unremitting nephrotic syndrome and inexorable progression to endstage kidney disease (2,4,6). Unfortunately, immunosuppressive therapy is frequently unsuccessful in the inherited forms of FSGS. Podocyte dysfunction is critical to the development of FSGS. Previously identified causal mutations in FSGS have shown the importance of a number of cytosolic genes encoding proteins that influence the podocyte cytoskeleton (e.g. ACTN4, which encodes alpha-actinin-4; MYH9, which encodes myosin heavy chain 9; INF2, which encodes inverted formin 2; and MYO1E, a gene that encodes myosin 1E, a non-muscle class I myosin). Through the exome sequencing strategy, we identified a novel causative mutation (R113W) in the NXF5 gene. In eukaryotes, the nuclear export of mRNA is mediated by nuclear export factor 1 (NXF1) receptors. Based on the extensive structural similarity of NXF family receptors, both within and across species, they are thought, like TAP/NXF1, to be involved in mRNA metabolism. For some of them, such activity has been confirmed by mRNA export assays (human NXF2), whereas the others (such as human NXF3) were inactive in these assays (29,30). In mice, Nxf2 and Nxf7 are analogues of human NXF2 and NXF5, respectively. Tretyakova et al. (28) showed that Nxf2 has properties similar to those of TAP/NXF1; in contrast, Nxf7 has cytoplasmic RNA transport factor properties. The study further showed that Nxf7 binds to the light chain (L chain) of the brain-specific microtubule-associated protein MAP1B, which interacts with cytoplasmic microtubules and actin filaments. Subcellular localization of mouse Nxf factors showed that GFP-Nxf7 was found only in small cytoplasmic foci, both in the cell body and in the neurites; it was excluded from the nucleus. GFP-Nxf7 formed mobile particles in the neurites, and a fraction of them moved unidirectionally. In both cell types, both anterograde and retrograde translocations were observed. The involvement of cytoskeletal components in Nxf7 particle motility was analysed with a short-duration colchicine treatment. This completely abolished the motility, indicating the involvement of microtubules. Our preliminary cellular studies show that the wt human NXF5 protein is localized in the nucleus and in the cytoplasm, including in the cellular processes, likes those observed for NXF2 (28). Moreover, the R113W mutation was observed to potentially affect the stability and the localization of the protein. Additional functional studies will be necessary to establish its role in the disease phenotype. A number of papers show that deletion or duplication in the NXF gene cluster, in particular, loss or overexpression of the NXF5 gene, cause severe mental retardation in men (31 – 34). Mutation analysis of the NXF5 gene and its neighbouring homologue, the NXF2 gene, did not identify causative mutations in 45 men with various forms of syndromic X-linked MR (XLMR) or in 70 patients with non-specific XLMR (32). Our patients do not show any cognitive impairment; however, it is not rare that different mutations in the same gene cause different phenotype manifestations. Furthermore, genes expressed in different tissues, when mutated, show alteration only in specific tissues. Mutations involving WT1, a tumour suppressor gene, lead to FSGS with multi-faceted clinical expressions such as Frasier syndrome (FSGS, XY hermaphroditism and high risk of gonadoblastoma) (35) and Bilateral Wilm’s tumour associated with FSGS (36). Abnormal splice variants of WT1 have also been associated with nonsyndromic FSGS. Again, in an analogous manner, mutations affecting the Chromatin bundling protein (SMARCAL1) cause Schimke syndrome (immuno-osseous dysplasia) (37) which has FSGS as one of the components. It is interesting to note that a number of women within this pedigree also reported pre-eclampsia. There are a number of publications in the literature that link pre-eclampsia with FSGS. Some have suggested that the occurrence of pre-eclampsia in families with FSGS may be indicative of being a carrier of FSGS genetic variants (38). Other detailed investigations of pre-eclampsia often identify FSGS lesions in the biopsies of patients. In this case, there is significant debate regarding whether pre-eclampsia causes FSGS or whether FSGS is a predating condition (39). Nagai suggests that FSGS-like lesions occur in pre-eclampsia but may not be progressive as proteinuria resolves after pregnancy (40). Similarly, Unverdi et al. (41) recently concluded that persistent proteinuria after delivery is a predictor of an underlying renal disease. The information we have available on the family shows a common occurrence of pre-eclampsia suggesting a genetic contributor. Thus while the occurrence of pre-eclampsia in this family may support the ‘carrier’ theory, it is difficult to conclusively determine as not all women with pre-eclampsia have had sons and some women in earlier generations do not report pre-eclampsia. The significance of the mutation in the ALG13 gene, which is an N-linked glycosylase is unclear. It is tempting to postulate a role for this mutation with the presence of IgA mesangial deposits, as defective glycosylation of IgA molecule is postulated to be one of the pathogenetic factors underlying IgA nephropathy (42). Again defective glycosylation of ion channel conductance proteins has been shown to underlie inherited cardiac conduction defects (43). However, preliminary studies in our lab do not suggest a functional significance for this mutation. The pathogenesis of the underlying cardiac conduction defect is a matter of speculation. Clinical observation suggests that the initial manifestation is first degree atrioventricular block with prolongation of P-R interval on the electrocardiogram. This appears to progress to third degree atrioventricular block with atrioventricular dissociation leading either to death in the earlier generations or needing cardiac pacemaker insertion in the current generations. One has to speculate that the same defects in the podocyte are likely to be the mechanisms leading to dysfunctional cardiac conduction, consequent to abnormalities in protein trafficking from the NXF5 gene mutation (44). Our expression studies, performed on RNA derived from patients’ blood, show that the mutation does not alter the expression or stability of the NXF5 transcript. In addition, the expression of the mutated allele in the female carriers demonstrates that there is no skewing of X inactivation, this may therefore explain the mild phenotype observed in the female carriers. We propose that the R113W mutation in the NXF5 gene identified in the examined FSGS family alters the biological function of the protein specifically in podocytes and in cardiac HISPurkinje system, producing an alteration in mRNA transport through cellular body and along the extensions. MATERIALS AND METHODS Sample ascertainment The study protocol was approved by the Griffith University Human Research Ethics Committee. The study complies with the Australian Health Ethics Committee (AHEC) and the National Statement on Ethical Conduct in Research Involving Humans (National Health and Medical and Medical Research Council) guidelines. All subjects gave informed consent prior to participation. In the case of minors, parental consent was obtained. A single, large, multigenerational Australian pedigree was utilized in this investigation and is depicted in Supplementary Material, Figure S1. Clinical details were gathered by screening medical records (where available), patient interviews and telephone interviews with treating physicians. Cause of death of deceased individuals was obtained either through interview or examination of family records and death certificates where available. Histological details were obtained from hospital records where available. Phenotypic data were available for 89 individuals (26 males and 63 females) ranging in age from 4 to 94 years old. All individuals were of Caucasian ancestry. DNA was available for 75 individuals (20 males; 56 females). The sampled individuals included four severely affected males and an additional mildly affected male with firstdegree heart block. DNA and genotyping For all participants over the age of 18 years, DNA was extracted from peripheral blood by means of a QIAmpw DNA Maxi Kit (Qiagen). For participants aged under 18 years, DNA was collected from buccal swaps and isolated using a QIAmpw DNA Mini Kit (Qiagen). Genotyping was performed at the Australian Genome Research Facility (AGRF), Melbourne. A total of 47 highly polymorphic microsatellite markers with an average density of 3.8 cM (minimum gap between markers 0.26 cM; maximum gap between markers 11.586) were genotyped across the entire X chromosome. Markers were amplified by PCR using fluorescently labelled primer pairs. All PCRs were performed in a total volume of 6 ml, using a PTC-225 DNA Engine Tetra (MJ Research Inc., Waltham, MA, USA) under standard conditions. PCR products were multiplexed and electrophoresed on a 3730 DNA Analyzer (Applied Biosystems). Data were analysed using Applied Biosystems Genescan version 3.1 and Genotyper version 2.1 software. We also used Affymetrix Genome-Wide Human SNP Array 6.0, containing more than 1.8 million genetic markers, including more than 906 600 single nucleotide polymorphisms (SNPs) and more than 946 000 probes for the detection of copy number variation (CNV). Genotypes of each SNP were generated with Birdseed v2. Quantile normalization was performed at probe level on the whole data set (sample + 240 references). For each single marker (SNP or CNV), the ratio in log 2 scale between the sample and reference set was then calculated. Linkage analysis Sex-averaged map positions were generated via locally weighted linear regression from NCBI build 35.1 physical map positions and the Rutgers genetic map (45). Pedstats version 0.6.8 was used to detect typing errors (46). Erroneous genotypes were removed prior to analysis. Multipoint non-parametric linkage analysis was undertaken using MINX version 1.1-alpha3 at 1 cM increments (46). LOD scores were calculated according to the Kong and Cox exponential model (47). Haplotyping was performed in MINX and results were graphically displayed using Progeny version 5 (http://www.progenygenetics. com/clinical/pedigree.html). MINX has a bit size limit of 24. Due to this computational constraint, the original pedigree was trimmed to facilitate analysis. The final trimmed pedigree structure was of 22 bit complexity (41 individuals; 22 males; 19 females) and contained all necessary individuals to examine the hypothesis of an X-linked recessive disease locus. DNA was available for 26 (12 males; 14 females) pedigree members individuals. Two genetic models were examined. In model 1, a total of 10 males (5 with DNA available) were classed as affected. In model 2, the male individual presenting with a milder version of the phenotype (ID113) was also classed as affected (11 affected individuals; 6 with DNA available). Whole-exome sequencing strategy Genomic DNA samples from two affected males belonging to the Australian FSGS pedigree (ID69, and ID85) were assayed using the NimbleGen SeqCap EZ ExomeTM capture kits (Roche) and resultant fragments sequenced with one lane per sample on an Illumina GAIIx (Illumina, San Diego, CA, USA) with 90 bp paired-end reads. A total of 44 363 000 (ID69) and 53 937 532 (ID85) paired-end reads were obtained and aligned to the human reference genome sequence (GRCh37/hg19) with MAQ7 and NextGENe software v2.00 with sequence condensation by consolidation (SoftGenetics, State College, PA, USA). This approach resulted in a coverage of all exons (including exon – intron boundaries) and 5′ and 3′ untranslated regions of more than ×40. Supplementary Material, Figure S3 depicts coverage of part of the COL4A5 gene located in the linkage interval. Single nucleotide variants (SNVs) were called with MAQ and NextGENe. Small insertions and deletions were detected with NextGENe. Called SNVs were annotated with SeattleSeq Annotation and were filtered with dbSNP131. Mutation analysis Validation and segregation analysis of the selected variants was performed by Sanger sequencing. PCR amplification and direct sequencing protocols have been previously described (48). Expression analysis NXF5 gene To examine the tissue-specific expression pattern of the NXF5 gene, real-time PCR was performed on total RNAs from human adult tissues purchased from Stratagene, with the LightCycler system DNA Engine Opticon 2 (MJ Research). One microgram of total RNA was reverse transcribed with the Transcriptor HiFi cDNA Synthesis kit (Roche). qPCRs were performed as described in previous paper (49). The expressions were normalized versus glyceraldehyde 3-phosphate dehydrogenase (GAPDH) to account for differences in starting material and cDNA reaction efficiency. Agarose gel electrophoresis was performed to further confirm the specific PCR products. NXF5 transcript primers were: NXF5-1F: 5′ TTACTGCGCCCTACTCTGTG 3′ NXF5-1R: 5′ CCATGCAGTTTCTTGATT 3′ NXF5-2F: 5′ CCCAGAGAGCCAGAGCCTAA 3′ NXF5-2R: 5′ TGATCATGAGTGGGGCAAAT 3′ NXF5-3F: 5′ AAGGATGGTCTCAGGGTTCT.3′ NXF5-3R: 5′ AAGCCTGCACCATTTCCTGT 3′ NXF5-4F: 5′ AAGGAAGGTGGTGGTGTTTG 3′ NXF5-3R: 5′ AAGCCTGCACCATTTCCTGT 3′ The last primer was used both with the primer NXF5-3F and with the primer NXF5-4F. The GAPDH primers were forward primer 5′ AGCCACATCGCTCAGACAC 3′ and reverse primer 5′ GATCTCGCTCCTGGAAGATG 3′. ALG13 gene Twenty-two transcripts are reported in Ensembl database (http:// www.ensembl.org/Homo_sapiens/Gene/Summary) for ALG13 gene, 6 of which are reported as protein coding. The AC/TT nucleotide change identified in our family is located in the intronic region in transcript 1 (long isoform) and in exonic region in transcripts 2 and 3 (short isoforms). We designed three different primer pairs, specific for the three isoforms to test their expression profile. The expression pattern was examined by real-time Kidneys were taken from mice aged between 7 and 10 days (max 15 days), and immediately immersed in culture medium (DMEM F12 medium supplemented with 10% FCS, 5 ug/ml transferrin, 10-7M hydrocortisone, 5 ng/ml sodium selenite, 0.12 U/ml insulin, 100 U/ml penicillin, 100 ug/ml streptomycin, 2 mM L-glutamine). The kidney was decapsulated, before passing through a series of sieves of decreasing mesh size: 100, 75, 50 and 36 mm. Glomeruli were collected from the top of the 36 mm sieves, centrifuged at 280g for 10 min at 48C. The pellet was re-suspended in the medium and further manually purified under a stereomicroscope by pipetting not only debris, but also the remaining glomeruli still surrounded by the Bowman’s capsule. The glomeruli were then seeded at 378C, in 5% CO2 humidified atmosphere, in culture flasks precoated with collagen type IV. After 7 – 10 days, glomeruli were ready to be detached by treatment with trypsin-EDTA, followed by filtering through the 36 mm mesh sieve to separate glomeruli from primary podocytes cells. When cultures were passaged, 90% of cells were identified as podocytes based on microscopy. These cells were seeded onto thermonax plastic collagen cover slips and characterized by immunocytochemistry (we used nephrin, podocin, cytokeratin, CD31, alpha-SMA, CD45). RNA preparation and RT-PCR assay were performed as already described (49), using the following mouse specific primers: Supplementary Material is available at HMG online. Conflict of Interest statement. None declared. SUPPLEMENTARY MATERIAL Alg13F-mouse: 5′ AGTCTGGAGAAAGGCAAACC 3′ Alg13R-mouse: 5′AATCCAACAACTTTATCCAA 3′ Nxf7F: 5′ TGTCCCAGACTTTCGCATTG 3′ Nxf7R: 5′ GCAGCTTCTGTGATTTAGGA 3′ Gapdh-F: 5′ TCCCTCAAGATTGTCAGCAA 3′ Gapdh-R: 5′ AGATCCACAACGGATACATT 3′ Plasmids preparation, cell culture and transfection The NXF5-337C (wt) construct was purchased from LifeSciences and the ALG13 cDNA clone (NM_018466) was synthesized at GeneCust Europe. These clones were used as template for the PCR reaction to generate the full-length cDNA fragments to introduce in pcDNA3.1D/V5-His-Topo vector (Invitrogen) and pEGFP-C1 and pEGFP-N2 vectors (Clontech). The R113W (NXF5) and T141L (ALG13) mutagenesis were carried out by the Quick Change II XL site-directed mutagenesis technique according to the manufacturer’s instructions (Stratagene). The whole coding sequences (NXF5 plus GFP, NXF5 plus His-Tag, ALG13 plus GFP and ALG13 plus His-Tag) of This work was supported by the Short-term Mobility Program from the Italian National Research Council to T.E., a Corbett Fellowship to R.A.L., a National Health and Medical Research Council Postgraduate scholarship to H.C.C., a National Health and Medical Research Council Fellowship (339462 and 613674) and an Australian Research Council Future Fellowship (FT0991022) to D.R.N. Research was also supported by a Griffith University Research Grant. REFERENCES 1. Ballermann , B.J. ( 2005 ) Glomerular endothelial cell differentiation . Kidney Int. , 67 , 1668 - 1671 . 2. Cameron , J.S. ( 2003 ) Focal segmental glomerulosclerosis in adults . Nephrol. Dial. Transplant., 18 (Suppl. 6), vi45 - vi51 . 3. D'Agati , V.D. ( 2008 ) The spectrum of focal segmental glomerulosclerosis: new insights . Curr. Opin. Nephrol. Hypertens., 17 , 271 - 281 . 4. Gbadegesin , R. , Lavin , P. , Foreman , J. and Winn , M. ( 2011 ) Pathogenesis and therapy of focal segmental glomerulosclerosis: an update . Pediatr. Nephrol. , 26 , 1001 - 1015 . 5. Pavenstadt , H. , Kriz , W. and Kretzler , M. ( 2003 ) Cell biology of the glomerular podocyte . Physiol. Rev. , 83 , 253 - 307 . 6. Rich , A.R . ( 1957 ) A hitherto undescribed vulnerability of the juxtamedullary glomeruli in lipoid nephrosis . Bull. Johns Hopkins Hosp. , 100 , 173 - 186 . 7. Koziell , A. , Grech , V. , Hussain , S. , Lee , G. , Lenkkeri, U. , Tryggvason , K. and Scambler , P. ( 2002 ) Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in nephrotic syndrome advocate a functional inter-relationship in glomerular filtration . Hum. Mol. Genet ., 11 , 379 - 388 . 8. Kao , W.H. , Klag , M.J. , Meoni , L.A. , Reich , D. , Berthier-Schaad , Y. , Li , M. , Coresh , J. , Patterson , N. , Tandon , A. , Powe , N.R . et al. ( 2008 ) MYH9 is associated with nondiabetic end-stage renal disease in African Americans . Nat. Genet. , 40 , 1185 - 1192 . 9. Kopp , J.B., Smith, M.W. , Nelson , G.W. , Johnson , R.C. , Freedman , B.I. , Bowden , D.W. , Oleksyk , T. , McKenzie , L.M. , Kajiyama , H. , Ahuja , T.S. et al. ( 2008 ) MYH9 is a major-effect risk gene for focal segmental glomerulosclerosis . Nat. Genet. , 40 , 1175 - 1184 . 10. Niaudet , P. and Gubler , M.C. ( 2006 ) WT1 and glomerular diseases . Pediatr. Nephrol., 21 , 1653 - 1660 . 11. Papeta , N. , Kiryluk , K. , Patel , A. , Sterken , R. , Kacak , N. , Snyder , H.J. , Imus , P.H. , Mhatre , A.N. , Lawani , A.K. , Julian , B.A. et al. ( 2011 ) APOL1 variants increase risk for FSGS and HIVAN but not IgA nephropathy . J. Am. Soc. Nephrol. , 22 , 1991 - 1996 . 12. Akilesh , S. , Suleiman , H. , Yu , H. , Stander , M.C. , Lavin , P. , Gbadegesin , R. , Antignac , C. , Pollak , M. , Kopp , J.B. , Winn , M.P. et al. ( 2011 ) Arhgap24 inactivates Rac1 in mouse podocytes, and a mutant form is associated with familial focal segmental glomerulosclerosis . J. Clin. Invest ., 121 , 4127 - 4137 . 13. Brink , P.A. , Ferreira , A. , Moolman , J.C. , Weymar , H.W. , van der Merwe , P.L. and Corfield , V.A. ( 1995 ) Gene for progressive familial heart block type I maps to chromosome 19q13 . Circulation , 91 , 1633 - 1640 . 14. Hinkes , B. , Wiggins , R.C. , Gbadegesin , R. , Vlangos , C.N. , Seelow , D. , Nurnberg , G. , Garg , P. , Verma , R. , Chaib , H. , Hoskins , B.E. et al. ( 2006 ) Positional cloning uncovers mutations in PLCE1 responsible for a nephrotic syndrome variant that may be reversible . Nat. Genet. , 38 , 1397 - 1405 . 15. Kaplan , J.M. , Kim , S.H. , North , K.N. , Rennke , H. , Correia , L.A. , Tong , H.Q. , Mathis , B.J. , Rodriguez-Perez , J.C. , Allen , P.G. , Beggs , A.H. et al. ( 2000 ) Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal segmental glomerulosclerosis . Nat. Genet. , 24 , 251 - 256 . 16. Kim , J.M. , Wu , H. , Green , G. , Winkler , C.A. , Kopp , J.B. , Miner , J.H. , Unanue , E.R. and Shaw , A.S. ( 2003 ) CD2-associated protein haploinsufficiency is linked to glomerular disease susceptibility . Science , 300 , 1298 - 1300 . 17. Lowik , M.M. , Groenen , P.J. , Levtchenko , E.N. , Monnens , L.A. and van den Heuvel , L.P. ( 2009 ) Molecular genetic analysis of podocyte genes in focal segmental glomerulosclerosis- a review . Eur. J. Pediatr. , 168 , 1291 - 1304 . 18. Lynch , D.K. , Winata , S.C. , Lyons , R.J. , Hughes , W.E. , Lehrbach , G.M. , Wasinger , V. , Corthals , G. , Cordwell , S. and Daly , R.J. ( 2003 ) A Cortactin-CD2-associated protein (CD2AP) complex provides a novel link between epidermal growth factor receptor endocytosis and the actin cytoskeleton . J. Biol. Chem. , 278 , 21805 - 21813 . 19. Mele , C. , Iatropoulos , P. , Donadelli , R. , Calabria , A. , Maranta , R. , Cassis , P. , Buelli , S. , Tomasoni , S. , Piras , R. , Krendel , M. et al. ( 2011 ) MYO1E mutations and childhood familial focal segmental glomerulosclerosis . N. Engl . J. Med., 365 , 295 - 306 . 20. Reiser , J. , Polu , K.R ., Moller , C.C. , Kenlan , P. , Altintas , M.M. , Wei , C. , Faul , C. , Herbert , S. , Villegas, I. , Avila-Casado , C. et al. ( 2005 ) TRPC6 is a glomerular slit diaphragm-associated channel required for normal renal function . Nat. Genet. , 37 , 739 - 744 . 21. Fernandez , P. , Moolman-Smook , J. , Brink , P. and Corfield , V. ( 2005 ) A gene locus for progressive familial heart block type II (PFHBII) maps to chromosome 1q32.2-q32 .3. Hum . Genet., 118 , 133 - 137 . 22. Liu , H. , El Zein , L. , Kruse , M. , Guinamard , R. , Beckmann , A. , Bozio , A. , Kurtbay , G. , Megarbane , A. , Ohmert, I. , Blaysat , G. et al. ( 2010 ) Gain-of-function mutations in TRPM4 cause autosomal dominant isolated cardiac conduction disease . Circ. Cardiovasc. Genet ., 3 , 374 - 385 . 23. Schott , J.J. , Alshinawi , C. , Kyndt , F. , Probst , V. , Hoorntje , T.M. , Hulsbeek , M. , Wilde , A.A. , Escande , D. , Mannens , M.M. and Le Marec , H. ( 1999 ) Cardiac conduction defects associate with mutations in SCN5A . Nat. Genet., 23 , 20 - 21 . 24. Becknell , B. , Zender , G.A., Houston, R., Baker , P.B. , McBride , K.L. , Luo , W. , Hains , D.S. , Borza , D.B. and Schwaderer , A.L. ( 2011 ) Novel X-linked glomerulopathy is associated with a COL4A5 missense mutation in a non-collagenous interruption . Kidney Int. , 79 , 120 - 127 . 25. Bilguvar , K. , Ozturk , A.K. , Louvi , A. , Kwan , K.Y. , Choi , M. , Tatli , B. , Yalnizoglu , D. , Tuysuz , B. , Caglayan , A.O. , Gokben , S. et al. ( 2010 ) Whole-exome sequencing identifies recessive WDR62 mutations in severe brain malformations . Nature , 467 , 207 - 210 . 26. Ng , S.B. , Buckingham , K.J. , Lee , C. , Bigham , A.W. , Tabor , H.K. , Dent , K.M. , Huff , C.D. , Shannon , P.T. , Jabs , E.W. , Nickerson , D.A. et al. ( 2010 ) Exome sequencing identifies the cause of a mendelian disorder . Nat. Genet. , 42 , 30 - 35 . 27. Otto , E.A. , Hurd , T.W. , Airik , R. , Chaki , M. , Zhou , W. , Stoetzel , C. , Patil , S.B. , Levy , S. , Ghosh , A.K. , Murga-Zamalloa , C.A. et al. ( 2010 ) Candidate exome capture identifies mutation of SDCCAG8 as the cause of a retinal-renal ciliopathy . Nat. Genet. , 42 , 840 - 850 . 28. Tretyakova , I., Zolotukhin , A.S. , Tan , W. , Bear , J. , Propst , F. , Ruthel , G. and Felber , B.K. ( 2005 ) Nuclear export factor family protein participates in cytoplasmic mRNA trafficking . J. Biol. Chem. , 280 , 31981 - 31990 . 29. Herold , A. , Suyama , M. , Rodrigues , J.P. , Braun, I.C. , Kutay , U. , Carmo-Fonseca , M. , Bork , P. and Izaurralde , E. ( 2000 ) TAP (NXF1) belongs to a multigene family of putative RNA export factors with a conserved modular architecture . Mol. Cell. Biol ., 20 , 8996 - 9008 . 30. Izaurralde , E. ( 2002 ) A novel family of nuclear transport receptors mediates the export of messenger RNA to the cytoplasm . Eur. J. Cell Biol ., 81 , 577 - 584 . 31. Chen , C.P. , Su , Y.N. , Lin , H.H. , Chern , S.R. , Tsai , F.J. , Wu , P.C. , Lee , C.C. , Chen , Y.T. and Wang , W. ( 2011 ) De novo duplication of Xq22.1- .q24 with a disruption of the NXF gene cluster in a mentally retarded woman with short stature and premature ovarian failure . Taiwan. J. Obstet. Gynecol. , 50 , 339 - 344 . 32. Frints , S.G. , Jun , L. , Fryns , J.P. , Devriendt , K. , Teulingkx , R. , Van den Berghe , L., De Vos , B. , Borghgraef , M. , Chelly , J. , Des Portes , V. et al. ( 2003 ) Inv(X)(p21.1;q22.1) in a man with mental retardation, short stature, general muscle wasting, and facial dysmorphism: clinical study and mutation analysis of the NXF5 gene . Am. J. Med. Genet. A , 119A , 367 - 374 . 33. Froyen , G. , Van Esch , H. , Bauters , M. , Hollanders , K. , Frints , S.G. , Vermeesch , J.R. , Devriendt , K. , Fryns , J.P. and Marynen , P. ( 2007 ) Detection of genomic copy number changes in patients with idiopathic mental retardation by high-resolution X-array-CGH: important role for increased gene dosage of XLMR genes . Hum. Mutat., 28 , 1034 - 1042 . 34. Jun , L. , Frints , S. , Duhamel , H. , Herold , A. , Abad-Rodrigues , J. , Dotti , C. , Izaurralde , E. , Marynen , P. and Froyen , G. ( 2001 ) NXF5, a novel member of the nuclear RNA export factor family, is lost in a male patient with a syndromic form of mental retardation . Curr. Biol ., 11 , 1381 - 1391 . 35. Klamt , B. , Koziell , A. , Poulat , F. , Wieacker , P. , Scambler , P. , Berta , P. and Gessler , M. ( 1998 ) Frasier syndrome is caused by defective alternative splicing of WT1 leading to an altered ratio of WT1 +/-KTS splice isoforms . Hum. Mol. Genet ., 7 , 709 - 714 . 36. Chernin , G. , Vega-Warner , V. , Schoeb , D.S. , Heeringa , S.F. , Ovunc , B. , Saisawat , P. , Cleper , R. , Ozaltin , F. and Hildebrandt , F. and Members of the , G.P. N.S.G. ( 2010 ) Genotype/phenotype correlation in nephrotic syndrome caused by WT1 mutations . Clin. J. Am. Soc. Nephrol. , 5 , 1655 - 1662 . 37. Boerkoel , C.F. , Takashima , H. , John, J. , Yan , J. , Stankiewicz , P. , Rosenbarker , L. , Andre , J.L. , Bogdanovic , R. , Burguet , A. , Cockfield , S. et al. ( 2002 ) Mutant chromatin remodeling protein SMARCAL1 causes Schimke immuno-osseous dysplasia . Nat. Genet. , 30 , 215 - 220 . 38. Rana , K. , Isbel , N. , Buzza , M. , Dagher , H. , Henning , P. , Kainer , G. and Savige , J. ( 2003 ) Clinical, histopathologic, and genetic studies in nine families with focal segmental glomerulosclerosis . Am. J. Kidney Dis. , 41 , 1170 - 1178 . 39. Gaber , L.W. , Spargo , B.H. and Lindheimer , M.D. ( 1994 ) Renal pathology in pre-eclampsia . Baillieres Clin. Obstet . Gynecol., 8 , 443 - 468 . 40. Nagai , Y. , Arai , H. , Washizawa , Y. , Ger , Y. , Tanaka , M. , Maeda , M. and Kawamura , S. ( 1991 ) FSGS-like lesions in pre-eclampsia . Clin. Nephrol ., 36 , 134 - 140 . 41. Unverdi , S. , Ceri , M. , Unverdi , H. , Yilmaz , R. , Akcay , A. and Duranay , M. ( 2013 ) Postpartum persistent proteinuria after preeclampsia: a single-center experience . Wien. Klin. Wochenschr. , 125 , 91 - 95 . 42. Amore , A. , Cirina , P. , Conti , G. , Brusa , P. , Peruzzi , L. and Coppo , R. ( 2001 ) Glycosylation of circulating IgA in patients with IgA nephropathy modulates proliferation and apoptosis of mesangial cells . J. Am. Soc. Nephrol. , 12 , 1862 - 1871 . 43. Bezzina , C.R. , Rook , M.B. and Wilde , A.A. ( 2001 ) Cardiac sodium channel and inherited arrhythmia syndromes . Cardiovasc. Res ., 49 , 257 - 271 . 44. Delisle , B.P. , Anson , B.D. , Rajamani , S. and January , C.T. ( 2004 ) Biology of cardiac arrhythmias: ion channel protein trafficking . Circ. Res ., 94 , 1418 - 1428 . 45. Duffy , D.L. ( 2006 ) An integrated genetic map for linkage analysis . Behav. Gen. , 36 , 4 - 6 . 46. Abecasis , G.R. , Cherny , S.S. , Cookson , W.O. and Cardon , L.R. ( 2002 ) Merlin-rapid analysis of dense genetic maps using sparse gene flow trees . Nat. Genet. , 30 , 97 - 101 . 47. Kong , A. and Cox , N.J. ( 1997 ) Allele-sharing models: LOD scores and accurate linkage tests . Am. J. Hum. Genet ., 61 , 1179 - 1188 . 48. Gennari , L. , Gianfrancesco , F. , Di Stefano , M. , Rendina , D. , Merlotti , D. , Esposito , T. , Gallone , S. , Fusco , P. , Rainero, I. , Fenoglio , P. et al. ( 2010 ) SQSTM1 gene analysis and gene-environment interaction in Paget's disease of bone . J. Bone Miner. Res ., 25 , 1375 - 1384 . 49. Esposito , T. , Magliocca , S. , Formicola , D. and Gianfrancesco , F. ( 2011 ) piR_015520 belongs to Piwi-associated RNAs regulates expression of the human melatonin receptor 1A gene . PLoS ONE , 6 , e22727 .


This is a preview of a remote PDF: http://hmg.oxfordjournals.org/content/22/18/3654.full.pdf

Teresa Esposito, Rod A. Lea, Bridget H. Maher, Dianne Moses, Hannah C. Cox, Sara Magliocca, Andrea Angius, Dale R. Nyholt, Thomas Titus, Troy Kay, Nicholas A. Gray, Maria P. Rastaldi, Alan Parnham, Fernando Gianfrancesco, Lyn R. Griffiths. Unique X-linked familial FSGS with co-segregating heart block disorder is associated with a mutation in the NXF5 gene, Human Molecular Genetics, 2013, 3654-3666, DOI: 10.1093/hmg/ddt215