SlNCED1 and SlCYP707A2: key genes involved in ABA metabolism during tomato fruit ripening

Journal of Experimental Botany, Oct 2014

Abscisic acid (ABA) plays an important role in fruit development and ripening. Here, three NCED genes encoding 9-cis-epoxycarotenoid dioxygenase (NCED, a key enzyme in the ABA biosynthetic pathway) and three CYP707A genes encoding ABA 8′-hydroxylase (a key enzyme in the oxidative catabolism of ABA) were identified in tomato fruit by tobacco rattle virus-induced gene silencing (VIGS). Quantitative real-time PCR showed that VIGS-treated tomato fruits had significant reductions in target gene transcripts. In SlNCED1-RNAi-treated fruits, ripening slowed down, and the entire fruit turned to orange instead of red as in the control. In comparison, the downregulation of SlCYP707A2 expression in SlCYP707A2-silenced fruit could promote ripening; for example, colouring was quicker than in the control. Silencing SlNCED2/3 or SlCYP707A1/3 made no significant difference to fruit ripening comparing RNAi-treated fruits with control fruits. ABA accumulation and SlNCED1transcript levels in the SlNCED1-RNAi-treated fruit were downregulated to 21% and 19% of those in control fruit, respectively, but upregulated in SlCYP707A2-RNAi-treated fruit. Silencing SlNCED1 or SlCYP707A2 by VIGS significantly altered the transcripts of a set of both ABA-responsive and ripening-related genes, including ABA-signalling genes (PYL1, PP2C1, and SnRK2.2), lycopene-synthesis genes (SlBcyc, SlPSY1 and SlPDS), and cell wall-degrading genes (SlPG1, SlEXP, and SlXET) during ripening. These data indicate that SlNCED1 and SlCYP707A2 are key genes in the regulation of ABA synthesis and catabolism, and are involved in fruit ripening as positive and negative regulators, respectively.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

http://jxb.oxfordjournals.org/content/65/18/5243.full.pdf

SlNCED1 and SlCYP707A2: key genes involved in ABA metabolism during tomato fruit ripening

Rch Pa KaiJi 1 WenbinKai 1 BoZhao 1 YufeiSun 1 BingYuan 0 ShengjieDai 1 QianLi 1 PeiChen 1 YaWang 1 YuelinPei 1 HongqingWang 1 YangdongGuo 1 PingLeng 1 0 Department of Chemistry and Biochemistry, University of Arizona, 1306 East University BouleVard , Tucson, USA 1 College of Agronomy and Biotechnology, China Agricultural University , Beijing 100193, PR China Abscisic acid (ABA) plays an important role in fruit development and ripening. Here, three NCED genes encoding 9-cis-epoxycarotenoid dioxygenase (NCED, a key enzyme in the ABA biosynthetic pathway) and three CYP707A genes encoding ABA 8-hydroxylase (a key enzyme in the oxidative catabolism of ABA) were identified in tomato fruit by tobacco rattle virus-induced gene silencing (VIGS). Quantitative real-time PCR showed that VIGS-treated tomato fruits had significant reductions in target gene transcripts. In SlNCED1-RNAi-treated fruits, ripening slowed down, and the entire fruit turned to orange instead of red as in the control. In comparison, the downregulation of SlCYP707A2 expression in SlCYP707A2-silenced fruit could promote ripening; for example, colouring was quicker than in the control. Silencing SlNCED2/3 or SlCYP707A1/3 made no significant difference to fruit ripening comparing RNAi-treated fruits with control fruits. ABA accumulation and SlNCED1transcript levels in the SlNCED1-RNAi-treated fruit were downregulated to 21% and 19% of those in control fruit, respectively, but upregulated in SlCYP707A2-RNAi-treated fruit. Silencing SlNCED1 or SlCYP707A2 by VIGS significantly altered the transcripts of a set of both ABA-responsive and ripening-related genes, including ABA-signalling genes (PYL1, PP2C1, and SnRK2.2), lycopene-synthesis genes (SlBcyc, SlPSY1 and SlPDS), and cell wall-degrading genes (SlPG1, SlEXP, and SlXET) during ripening. These data indicate that SlNCED1 and SlCYP707A2 are key genes in the regulation of ABA synthesis and catabolism, and are involved in fruit ripening as positive and negative regulators, respectively. - Abscisic acid (ABA) plays an important role in plant growth, stomatal movement, seed dormancy, and germination (Melcher et al., 2009; Nishimura et al., 2009). Moreover, it mediates adaptive responses to abiotic and biotic stresses (Chernys and Zeevaart, 2000; Shang etal., 2010). At present, major progress has been made in research into the role of ABA in the regulation of fleshy fruit ripening (Rodrigo etal., 2006; Zhang et al., 2009a, b; Giribaldi et al., 2010). These physiological processes controlled by ABA are primarily regulated by the bioactive ABA pool size, which is thought to be maintained not only by its biosynthesis, but also by its catabolism (Sawada etal., 2008). The ABA metabolic pathway has been established by genetic approaches. ABA is synthesized de novo from a C40 carotenoid. The carotenoid-biosynthetic pathway begins with the formation of phytoene from two molecules of geranylgeranyl diphosphate (GGPP) in the central isoprenoid pathway. Four desaturation steps give rise to lycopene; cyclizations at both ends of the lycopene molecule produce -or -carotene, which undergo hydroxylation at C3 and C3 to form the xanthophylls lutein and zeaxanthin, The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. respectively. An important phase of ABA biosynthesis is initiated in plastids with the hydroxylation and epoxidation of the -carotene to produce the all-trans xanthophylls zeaxanthin and violaxanthin. Violaxanthin is then converted into 9-cisepoxyxanthophylls, which are oxidatively cleaved by 9-cisepoxycarotenoid dioxygenase (NCED) to yield xanthoxin, the first C15 intermediate of ABA biosynthesis. Xanthoxin exits the plastid into the cytosol where it is oxidized in two further steps to form ABA (Schwartz et al., 2003; Taylor etal., 2005). In addition, the ABA metabolic pathway plays an important role in the regulation of ABA levels (Cutler and Krochko, 1999; Schwartz et al., 2003). The hydroxylation pathway is the main ABA catabolic pathway. In the hydroxylation pathway, among three different methyl groups, C8 is the predominant position for the hydroxylation reaction, which is mediated in Arabidopsis by proteins encoded by the CYP707A gene family (Saito etal., 2004; Kushiro etal., 2004). Dihydroxyphaseic acid (DPA) may be the major metabolite of ABA (Setha etal., 2005). The 8-hydroxylation is reported to be the major regulatory step in many physiological events controlled by ABA (Kushiro etal., 2004; Saito etal., 2004). Recently, a major breakthrough in the field of ABA signalling was achieved with the identification of the PYR/PYL/RCAR protein family, the type 2C protein phosphatases (PP2Cs), and subfamily 2 of the SNF1-related kinases (SnRK2s) (Ma etal., 2009; Park etal., 2009; Melcher etal., 2009; Santiago etal., 2009). To elucidate the mechanism of ABA action, it is necessary to identify all the components involved in ABA homeostasis, including the functional components in ABA metabolic pathways, signal transduction, and transport. In tomato (Solanum lycopersicum), three NCED genes have been isolated, and expression analysis indicated that, among them, SlNCED1 may regulate ABA biosynthesis in fruit (Sun etal., 2012a, b). However, the molecular evidence remains to be elucidated. To address this, a key step in ABA biosynthesis, NCED was targeted for inhibition via RNAi in tomato fruit two years previously. Four independent transgenic plants were evaluated (Sun et al., 2012a, b). Our data showed that ABA potentially regulated the development and ripening of tomato fruit. In addition, ABA could control, at least in part, the production and effects of ethylene in climacteric tomato fruit. In recent years, tobacco rattle virus-induced gene silencing (VIGS) has been used as a rapid gene function assay system in molecular biological studies of fleshy fruit (Fu etal., 2006; Hoffmann et al., 2006; Li et al., 2013). In this study, we further identify the function of three NCED and three CYP707A genes by VIGS. Results show that SlNCED1 and SlCYP707A2 are key genes in the regulation of ABA level during development and ripening of tomato fruit. Materials and methods Construction of the viral vector and agroinoculation The pTRV1 and pTRV2 virus-induced gene silencing vectors (described by Liu et al., 2002) were kindly provided by YL Liu (School of Life Science, Tsinghua University, Beijing, China). A 456 bp cDNA fragment of an NCED or CYP707A gene was amplified using primers (Table 1). The amplified fragment was cloned into EcoRI/SacI-digested pTRV2. Agrobacterium tumefaciens strain GV3101 containing pTRV1, pTRV2, and the pTRV2derivative pTRV2-NCED/CYP707A were used for RNAi. Thirty fruits from ten independent plants grown in the greenhouse were selected for inoculation, and each basal pedicel or one side of fruit was injected with the NCED/CYP707A-RNAi TRV vector at the maturation green stage. The fruits were evaluated 312 days after treatment. Plant materials Tomatoes (Solanum lycopersicum L.cv. JiaBao) were grown under standard greenhouse conditions (25 5C and 70% humidity under a 14 h/10 h light/dark regime). Fruit ripening stages were divided according to the days after flowering (DAF) and fruit colour: immature green (IM), 15 DAF; mature green (MG), 30 DAF; breaker 0 (B0), 34 DAF; breaker 1 (B1), 35 DAF; breaker 2 (B2), 36 DAF; turning 0 (T0), 37 DAF; turning 3 (T3), 40 DAF; red ripe (R), 42 DAF; and over ripe (OR), 45 DAF. Ten fruits were harvested at each stage and immediately frozen in liquid nitrogen. They were then powdered, mixed, and stored at 80oC until further use. Tom tomatoes were also grown in the same greenhouse. Dehydration treatment offruits In order to evaluate the effect of dehydration stress, 60 fruits were harvested at the MG stage and divided evenly into two groups. The first group (control) was stored at 20C under high relative humidity (RH) (95%) which included 10 control fruits, 10 SlNCED1-RNAitreated fruits, and 10 SlCYP707A2-RNAi-treated fruits. The second group (dehydration stress) was stored at the same temperature and subjected to the same treatments, but under low RH (55%, dehydrated fruits). The ABA content and expression of related genes in the pulp were determined 0, 3, 5, and 7 d after the treatment of fruits and 0, 1, and 2 d after the treatment of sepals. Every single fruit was weighed immediately after harvest and then weighed again before sampling for calculation of water loss rate. Water loss rate is calculated as the ratio of the decreased fruit weight to the initial fruit weight. ABA or NDGA treatment Sixty fruits harvested at the MG stage were divided into two groups (n=30 for each group), and immediately soaked in 100M ABA (Sigma, A1049, USA) (group I) or distilled water (group II, control) for 10 min under low vacuum. The fruits were then placed in a tissue culture room at 25C and 95% RH. After 0, 1, and 3d, the fruits were sampled, frozen with liquid nitrogen, powdered, mixed, and stored at 80oC for further use. Different treatments with Table1. Specific primers used for VIGS in this study Oligonucleotides (5-3) CGGGAATTCTAGTTACGCTTGCCGTTTCACTGAA CGGGAGCTCTCAGGAATGACGACGAAGTTCTCAG CGGGAATTCACAAGACGACAACTACTTTCACCCT CGGGAGCTCTCTAGAGTCATGGCATTTACAATTTG CGGGAATTCTCCACGACCCGAATAAAGTATCT CGGGAGCTCGTCTTGTTTACTTGTCCCGCTTC CGGGAATTCCATTTGGATGGTCATGTTAAGGA CGGGAGCTCCAAATAACTTTCTGTTCAGCCTTGA CGGGAATTCTCTTTGCAGCTCGAGACACTACTGC CGGGAGCTCTCCAGCTTGGCTAAGTCATTCCCT CGGGAATTCTTTCAAGACTCACATATTGGGATG CGGGAGCTCTAGCACCTCTTTAGATCCTCCCT nordihydroguaiaretic acid (NDGA) were the same as with ABA; NDGA concentration was 200M. Quantitative real-time PCR analysis Total RNA was isolated from tomato samples using the hot borate method (Wan and Wilkins, 1994). Genomic DNA was eliminated using an RNase-free DNase Ikit (Takara, China) according to the manufacturers recommendations. For every RNA sample, quality and quantity were assessed by agarose gel electrophoresis. cDNA was synthesized from total RNA using the PrimeScriptTM RT reagent kit (Takara) according to the manufacturers recommendations. Primers used for real-time PCR are listed in Supplementary Table S1 and were designed using Primer 5 software (http://www.premierbiosoft.com/). SAND was used as an internal control gene, and the stability of its expression was tested in preliminary studies (Sun etal., 2011). All primer pairs were tested by PCR. The presence of a single product of the correct size for each gene was confirmed by agarose gel electrophoresis and double-strand sequencing (Invitrogen). The amplified fragment of each gene was subcloned into the pMD18 T vector (Takara), and used to generate standard curves through serial dilution. The real-time PCR was performed using a RotorGene 3000 system (Corbett Research, China) with SYBR Premix Ex TaqTM (Takara). Each 20l reaction solution contained 0.8l of primer mixer (containing 4M of each forward and reverse primer), 1.5 l cDNA template, 10 l SYBR Premix Ex TaqTM (2X) mixer, and 7.7l water. Reactions were performed under the following conditions: 95C for 30 s (one cycle), 95C for 15 s, 60C for 20 s, and 72C for 15 s (40 cycles). The changes of relative fold expression were calculated using the relative two standard curves method with Rotor-Gene 6.1.81 software (Invitrogen). Determination of ABA content For ABA extraction, 1.0 g of pulp was ground in a mortar and homogenized in the extraction solution (80% v/v methanol). Extracts were centrifuged at 10 000g for 20 min. The supernatant was eluted through a Sep-Pak C18 cartridge (Waters, www.waters.com) to remove polar compounds, and then were stored at 20C for ELISA. The stepwise procedure for indirect ELISA of ABA was as follows: each well of a microtitre plate was pre-coated with ABABSA conjugater diluted in coating buffer according to the instructions of the manufacturer (ELISA kit for ABA, College of Agronomy and Biotechnology, China Agricultural University). Then, to each well, was added 50 l standard or sample in assay buffer (8.0 g NaCl, 0.2 g KH2PO4, 2.96 g Na2HPO412 H2O, 1.0 ml Tween 20, and 1.0 g gelatin, added to 1.000 ml water), followed by 50l ABA antibody (Invitrogen) diluted 1:2000 in assay buffer. The plates were incubated for 0.5 h at 37C and then washed four times with scrubbing buffer (which contained the same ingredients as assay buffer, but without gelatin). Anti- mouse IgG coupled to alkaline phosphatase (100 ml of a 1:1000 dilution) was added to each well, and the plates were incubated for 0.5 h at 37C. The plates were washed as above, and then 100l of a 12 mg ml1 o-phenylenediamine substrate solution and 0.04% by volume of 30% v/v hydrogen peroxide in substrate buffer (5.10 g C6H8O7H2O, 18.43 g Na2HPO412 H2O, and 1.0 ml Tween 20, added to 1000 ml water) were added to each well. After 1015 min, 50l of 2.0 mol l1 H2SO4 was added to each well to terminate the reaction. The absorbance was measured at 490 nm using a Thermo Electron (Labsystems) Multiskan MK3 (Pioneer, www. pioneerbiomed.com). The concentration of ABA in the sample was calculated from log B/B0-transformed standard curve data, where B and B0 are the absorbance values with or without the competing antigen, respectively. Determination of ethylene production The ethylene production of the fruit was measured by enclosing three fruits in 1.0 l airtight containers for 2 h at 20C, withdrawing 1 ml of the headspace gas, and injecting it into a gas chromatograph (Agilent model 6890N) fitted with a flame ionization detector and an activated alumina column. Fresh tissues from each fruit were frozen in liquid nitrogen and stored at 80C until use. Determination of fruit firmness Fruits were harvested from all of the plants in each of three replicate plantings at the different ripening stages. Flesh firmness was measured after the removal of fruit skin on three sides of each fruit using a KM-model fruit hardness tester (Fujihara). The strength of flesh firmness was recorded in kg cm1. Compression of each fruit was measured three times, and the average of the maximum force was used. Expression patterns of ABA metabolic genes in pulp during fruit development and in response to application of exogenous ABA and dehydrationstress Within the SlNCED gene family, the expression of SlNCED1 was the highest in pulp. SlNCED1 decreases from 10 days after full bloom (DAFB) to the MG stage, then it increased sharply and peaked at the turning stage; after that it declined to a low level at the OR stage (Fig.1A). The expression variation of SlNCED2 was generally decreased from 10 DAFB to fruit ripening. The expression of SlNCED3 was very low through fruit development and ripening. Among the SlCYP707A gene family, the expression of SlCYP707A2 (Fig. 1B) exhibited a fluctuant expression pattern with four peaks during development, and then it increased rapidly during ripening. Compared to SlCYP707A2, the expression of SlCYP707A1 and SlCYP707A3 (Fig.1B) was very low during fruit development and ripening. In addition, expression of ABA metabolic genes in response to exogenous ABA treatment and dehydration in tomato fruits was tested. For SlNCED1, expression was significantly increased by exogenous ABA and dehydration at 2days after treatment (DAT) (Fig. 1C, E). The expression of SlNCED2 and SlNCED3 was also significantly increased in the water stressed and ABA-treated tomato fruits (Fig. 1C, E). For SlCYP707A2, expression was downregulated in the fruits under both ABA treatment and dehydration at 1 DAT (Fig.1D, F), and then it significantly increased at 2 DAT (Fig.1D, F). The expression of SlCYP707A1 and SlCYP707A3 was significantly downregulated under both water stress and ABA treatment at 1 DAT, but upregulated at 2DAT. Silencing of the SlNCED1 gene suppresses tomato fruit ripening To examine the role of SlNCEDs, the tobacco rattle virus (TRV) vector was used to suppress the expression of SlNCEDs (Fig.2). When the SlNCED1-RNAi TRV vector was injected into the basal pedicel of 15 fruits (cv. Tom) attached to the plant at the MG stage, fruit ripening slowed down, and the entire fruit turned orange (Fig. 3D, E,F) instead of red as in the control (Fig.3A). Ten days after the SlNCED1-RNAi TRV vector was injected, the fruits did not show normal ripening (Fig.3D, E, F) as in the control (Fig.3A). Compared to SlNCED1-RNAi-treated fruits, there were no significant differences in colouring between SlNCED2/3-RNAi-treated fruits and control fruits (Fig.3B, C) during fruit ripening and in response to dehydration stress. The SlNCED1-RNAi TRV vector was also injected into the attached fruits (cv. JiaBao) at the MG stage. 12 d after injection, control fruits turned red (Fig. 3M, N); however, for SlNCED1-RNAi-treated fruits, parts of the peel and placenta inside the fruit did not turn red as in the control (Fig.3K, L). The water loss of the sepal in the SlNCED1-RNAi-treated fruits was quicker than in the control under the same conditions. Meanwhile, the wilting of the sepals was more serious than that of the control under the same conditions. SlNCED1-RNAi treatment alters the expression of genes involved in ABA-responsivegenes In SlNCED1-RNAi-treated fruits, expression of SlNCED1 was markedly downregulated to 19% of the control while expression of SlNCED2/SlNCED3 was downregulated/ upregulated (Fig. 4A, B, C). In fruits with the same treatment, the expression of SlCYP707A1/2 was downregulated, while the expression of SlCYP707A3 was upregulated (Fig.4D, E, F). Among the ABA-signalling genes, including those of the PYR/PYL/RCAR protein family (SlPYL1), type 2C protein phosphatases (SlPP2C1), and subfamily 2 of SNF1-related kinases (SlSnRK2.2) (Ma etal., 2009; Park et al., 2009), SlPYL1and SlSnRK2.2 were downregulated while SlPP2C1 was upregulated (Fig.4G, H, I). As shown in Fig.5A, in SlNCED1-RNAi-treated fruits, the ABA content was 21% of the control at the turning stage (7 d after MG); moreover, fruits couldnt become fully red and this incomplete colouring couldnt be rescued by the application of exogenous ABA (although ABA contents were increased by application of exogenous ABA) (Fig.5A). Expression of SlPYL1 and SlSnRK2.2 in SlNCED1-RNAi-treated fruits couldnt be increased by application of exogenous ABA (Fig.5B). Fig.4. Expression of ABA-responsive genes in both control and SlNCED1-RNAi-treated fruit during development and ripening of tomato. The JiaBao fruits were injected with SlNCED1-RNAi TRV vectors at THE MG stage. Fruits were sampled 0 d (MG), 5 d (B), 7 d (T), 9 d (HR), and 12days (OR) after the inoculation, respectively. SAND mRNA was used as the internal control. Three biological replicates (n=3) were used for each analysis. *P value t-test < 0.05; **P value t-test < 0.001. Error bars are SE. SlNCED1-RNAi treatment alters the expression of genes involved in ripening-relatedgenes Several ripening-related physiological parameters were measured, including fruit firmness, solid soluble content, and lycopene content. As shown in Fig. 6, in SlNCED1RNAi fruits, the trends were for a decrease in solid soluble content and lycopene content, but an increase in fruit firmness. To clarify the role of SlNCED1 in the regulation of tomato fruit ripening, several ripening-related genes were examined in both SlNCED1-RNAi-treated fruits and control fruits. SlBcyc, SlPSY1 and SlPDS encode lycopene -cyclase, phytoene synthetase, and phytoene dehydrogenase, respectively. Relative quantitative real-time PCR analysis showed that the expression of all these genes was downregulated (Fig. 7H, I) except for SlBcyc, which was upregulated (Fig.7J). In addition, we examined the expression of genes encoding cell-wall hydrolases. In SlNCED1RNAi fruit, genes encoding polygalacturonase (SlPG1), expansin (SlEXP1), and xyloglucan endotransglycosylase (SlXET16) were all significantly downregulated during fruit ripening compared to the control (Fig.7E, F, G). Relative expression analysis showed that the expressions of SlACS2 [encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase], SlACO1 (encoding ACC oxidase), and SlETR3 (involved in the ethylene response), were upregulated in the SlNCED1-RNAi fruits (Fig.7A, B, C). The expression of SlERF2 was significantly downregulated in SlNCED1RNAi fruits (Fig.7D). Ethylene release was upregulated at turning stage, but downregulated at harvest red stage compared to the control (Fig.7K). Silencing of the SlCYP707A2 gene promotes tomato fruit colouring To clarify the role of SlCYP707A2 in the regulation of ABA levels during fruit ripening, ABA levels and ABA-responsive genes were examined in both RNAi-treated and control fruits. When the SlCYP707A2 -RNAi TRV vector was injected into the 15 fruits attached to the plant at the MG stage, the fruits could become red quicker (Fig. 8F), and ripening was also faster than in the control (Fig. 8G). In SlCYP707A1/2/3RNAi-treated Tom fruits (Fig.8B, C, D), fruit ripening (Fig.8B, C, D) was the same as with control fruit (Fig.8A) at harvest stage. In SlCYP707A2-RNAi-treated fruits, the ABA content was higher than the control at 5 and 7 d after MG, and fruit ripening couldnt be inhibited by the application of NDGA, which delayed the control fruit ripening (Fig.9J). SlCYP707A2-RNAi treatment alters the expression of genes involved in ABA-responsivegenes In the SlCYP707A2-RNAi-treated fruits, expression of SlCYP707A1 was downregulated, but SlCYP707A3 Fig.5. Changes in ABA content, SlPYL1 and SlSnRK2.2 expression, and numbers of fully red fruit 9 d after exogenous ABA treatment in both control and SlNCED1-RNAi-treated fruit. 78 JiaBao fruits were equally divided into two groups at the MG stage and then injected with 1 ml ABA (100 mM) for group 1, or distilled water for group 2 (control). 30 fruits were used for the investigation of number of fully red fruits and others were sampled at 0, 5, 7, and 9 d after ABA treatment, respectively, for the determination of ABA content and gene expression. SAND mRNA was used as the internal control. Three biological replicates (n=3) were used for each analysis. *P value t-test < 0.05; **P value t-test < 0.001. Error bars are SE. was upregulated; however, SlCYP707A2 was markedly downregulated to 18% of the control (Fig.9D, E, F). The expression of SlNCED1/3 was upregulated, while SlNCED2 was downregulated in SlCYP707A2-RNAi fruits (Fig.9A, B, C). The expression of SlPYL1 and SlSnRK2.2 in ABA signalling was upregulated, while SlPP2C1 expression was downregulated in SlCYP707A2RNAi fruit (Fig.9G, H, I). SlCYP707A2-RNAi treatment alters the expression of genes involved in ripening-relatedgenes As shown in Fig.6, fruit firmness was lower than that of the control in SlCYP707A2-RNAi fruits, while the soluble solid content and lycopene content did not show significant differences compared to the control fruits. In SlCYP707A2-RNAi fruits, genes encoding polygalacturonase (SlPG), expansin (SlEXP) and xyloglucan endotransglycosylase (SlXET16) Fig.6. Changes in fruit firmness, solid soluble, and lycopene content in control, SlNCED1-RNAi-treated, and SlCYP707A2-RNAi-treated fruits. Every nine JiaBao fruits from control, SlNCED1-RNAi-treated, and SlCYP707A2-RNAi-treated fruits, respectively, were harvested at the harvest red stage. Three biological replicates (n=3) were used for each analysis. *P value t-test < 0.05; **P value t-test < 0.001. Error bars are SE. were upregulated at breaker and turning stages; however, there were no significant changes compared to the control fruits at the harvest stage (Fig.10E, F, G). In the lycopene synthesis pathway, compared with the control, the relative expression levels of SlPSY1 and SlPDS were higher, but SlBcyc was lower, at breaker and turning stages (Fig.10H, I, J). With respect to ethylene, relative expression analysis showed that the expression of SlACS2 [encoding (ACC) synthase], SlACO1 (encoding ACC oxidase), and SlETR3 (involved in the ethylene response), which were consistent with ethylene release (Fig.10K) in the SlCYP707A2-RNAi fruits, were upregulated at breaker and turning stages; however, there was no significant difference at harvest stage compared to control fruits (Fig. 10J). The expression of the SlERF2 was upregulated at the T and HR stages. SlCYP707A2-RNAi-treated fruits during the harvest stage were unusual, with uneven colouring in pulp compared to control fruits. Dehydration of SlNCED1/ SlCYP707A2-RNAi-treatedfruits Both control and SlNCED1/SlCYP707A2-RNAi-treated fruits were harvested 6 d after the SlNCED1/SlCYP707A2RNAi treatments (Fig. 11). The fruits were then incubated in the laboratory (20C, 50% relative humidity). As shown in Fig.11, the weight loss rate in SlNCED1-RNAi fruits was higher than the control fruit 36 d after dehydration. However, there was not a large difference in the rate of water loss comparing control and SlCYP707A2-RNAi fruit (Fig.11A). The water loss of the sepal in the SlNCED1/SlCYP707A2-RNAi treated fruit was also similar to that of fruit under the same conditions (Fig.11B). Discussion NCED and CYP707A are generally encoded by a small gene families, respectively (Krochko etal., 1998; Burbidge etal., 1999; Zhang etal., 2009a). Among the three NCED genes in tomato, SlNCED1 may play a primary role in regulating ABA biosynthesis during fruit ripening (Fig. 1A) in response to ABA application (Fig.1E) and dehydration (Fig.1C). Besides biosynthesis, catabolism of ABA is also an important way of regulating ABA levels (Kushiro etal., 2004; Li et al., 2011; Ren et al., 2011). A similar result to the reports of Ren et al. (2010) and Wang et al. (2013) was obtained in this work: the expression of SlCYP707A2 was higher than SlCYP707A1 and SlCYP707A3, and was opposite to the change of ABA content during development (Fig.1B) in response to ABA treatment (Fig.1F) and dehydration (Fig. 1D). Previously, to suppress SlNCED1 specifically in tomato fruits, we used an RNA interference bars are SE. Fig.11. Effects of dehydration stress on control, SlNCED1-RNAi-treated, and SlCYP707A2-RNAi-treated fruits. Fruits at the MG stage were placed into an incubator: control, 25oC and 90% relative humidity; dehydration, 25oC and 45% relative humidity. Fruits were sampled 0, 3, and 6 d after dehydration treatment (DADT), respectively. The sepal samples were collected at 1 and 2 DADT. Three biological replicates (n=3) were used for each analysis. *P value t-test < 0.05; **P value t-test < 0.001. Error bars are SE. Supplementary material Supplementary data can be found at JXB online. Supplementary Table S1. Specific primer sequences used for real-time quantitative PCR. This work was partly supported by the 973 Programme 2012CB113900 to Yang-Dong Guo.


This is a preview of a remote PDF: http://jxb.oxfordjournals.org/content/65/18/5243.full.pdf

Kai Ji, Wenbin Kai, Bo Zhao, Yufei Sun, Bing Yuan, Shengjie Dai, Qian Li, Pei Chen, Ya Wang, Yuelin Pei, Hongqing Wang, Yangdong Guo, Ping Leng. SlNCED1 and SlCYP707A2: key genes involved in ABA metabolism during tomato fruit ripening, Journal of Experimental Botany, 2014, 5243-5255, DOI: 10.1093/jxb/eru288