CD47 Promotes Protective Innate and Adaptive Immunity in a Mouse Model of Disseminated Candidiasis

PLOS ONE, May 2015

CD47 is a widely expressed receptor that regulates immunity by engaging its counter-receptor SIRPα on phagocytes and its secreted ligand thrombospondin-1. Mice lacking CD47 can exhibit enhanced or impaired host responses to bacterial pathogens, but its role in fungal immunity has not been examined. cd47-/- mice on a C57BL/6 background showed significantly increased morbidity and mortality following Candida albicans infection when compared with wild-type mice. Despite normal fungal colonization at earlier times, cd47-/- mice at four days post-infection had increased colonization of brain and kidneys accompanied by stronger inflammatory reactions. Neutrophil and macrophage numbers were significantly elevated in kidneys and neutrophils in the brains of infected cd47-/- mice. However, no defect in phagocytic activity towards C. albicans was observed in cd47-/- bone-marrow-derived macrophages, and neutrophil and macrophage killing of C. albicans was not impaired. CD47-deficiency did not alter the early humoral immune response to C. albicans. Th1, Th2, and Th17 population of CD4+ T cells were expanded in the spleen, and gene expression profiles of spleen and kidney showed stronger pro-inflammatory signaling in infected cd47-/- mice. The chemoattractant chemokines MIP-2α and MIP-2β were highly expressed in infected spleens of cd47-/- mice. G-CSF, GM-CSF, and the inflammasome component NLRP3 were more highly expressed in infected cd47-/- kidneys than in infected wild-type controls. Circulating pro- (TNF-α, IL-6) and anti-inflammatory cytokines (IL-10) were significantly elevated, but IL-17 was decreased. These data indicate that CD47 plays protective roles against disseminated candidiasis and alters pro-inflammatory and immunosuppressive pathways known to regulate innate and T cell immunity.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

CD47 Promotes Protective Innate and Adaptive Immunity in a Mouse Model of Disseminated Candidiasis

May CD47 Promotes Protective Innate and Adaptive Immunity in a Mouse Model of Disseminated Candidiasis Dhammika H. M. L. P. Navarathna 0 1 2 3 Erica V. Stein 0 1 2 3 Elizabeth C. Lessey-Morillon 0 1 2 3 Debasis Nayak 0 1 2 3 Gema Martin-Manso 0 1 2 3 David D. Roberts 0 1 2 3 0 1 Laboratory of Pathology, Center for Cancer Research, National Cancer Institute , Bethesda, MD 20892 , United States of America, 2 National Institute of Neurological Disorders and Stroke, National Institutes of Health , Bethesda, MD 20892 , United States of America, 3 Microbiology and Immunology Program of the Institute for Biomedical Sciences, Departments of Microbiology, Immunology and Tropical Medicine, George Washington University , Washington, D.C. 20037 , United States of America 1 Funding: This work was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research (DDR) and the National Institute of Neurological Disorders and Stroke (DN) 2 Academic Editor: Julian R Naglik, King's College London Dental Institute, UNITED KINGDOM 3 a Current address: Biosciences and Biomedical Engineering, Indian Institute of Technology, Indore, India b Current address: Program for Cell Enhancement and Technologies for Immunotherapy, Center for Cancer and Immunology Research, Children's National Health System , Washington, DC 20010 , United States of America CD47 is a widely expressed receptor that regulates immunity by engaging its counter-receptor SIRP on phagocytes and its secreted ligand thrombospondin-1. Mice lacking CD47 can exhibit enhanced or impaired host responses to bacterial pathogens, but its role in fungal immunity has not been examined. cd47-/- mice on a C57BL/6 background showed significantly increased morbidity and mortality following Candida albicans infection when compared with wild-type mice. Despite normal fungal colonization at earlier times, cd47-/mice at four days post-infection had increased colonization of brain and kidneys accompanied by stronger inflammatory reactions. Neutrophil and macrophage numbers were significantly elevated in kidneys and neutrophils in the brains of infected cd47-/- mice. However, no defect in phagocytic activity towards C. albicans was observed in cd47-/- bone-marrowderived macrophages, and neutrophil and macrophage killing of C. albicans was not impaired. CD47-deficiency did not alter the early humoral immune response to C. albicans. Th1, Th2, and Th17 population of CD4+ T cells were expanded in the spleen, and gene expression profiles of spleen and kidney showed stronger pro-inflammatory signaling in infected cd47-/- mice. The chemoattractant chemokines MIP-2 and MIP-2 were highly expressed in infected spleens of cd47-/- mice. G-CSF, GM-CSF, and the inflammasome component NLRP3 were more highly expressed in infected cd47-/- kidneys than in infected wild-type controls. Circulating pro- (TNF-, IL-6) and anti-inflammatory cytokines (IL-10) were significantly elevated, but IL-17 was decreased. These data indicate that CD47 plays - Candida albicans is a commensal in the gastrointestinal tract and the most common human fungal pathogen [1]. It is the fourth leading cause of nosocomial infections in the United States [2]. Disseminated candidiasis is often fatal in immunocompromised individuals, but superficial oral thrush and vaginal yeast infections can also affect immunocompetent individuals [3]. Virulence attributes of C. albicans include secretion of extracellular proteases and carbon monoxide, expression of host adhesion receptors, and phenotypic switching to invasive hyphal forms during infection [4,5]. These virulence attributes enable invasion of host tissues and also control the host immune response by altering immune cell differentiation and cytokine production [4]. A better understanding of this host-pathogen cross-talk during disseminated candidiasis is needed to identify targets for novel drugs to supplant existing antifungal agents and counter emerging drug resistance. Several aspects of human disseminated candidiasis can be effectively modeled in mice and have contributed to our present understanding of cell mediated and innate immune responses to C. albicans infection [6]. Neutrophils are the primary defense against a C. albicans infection, whereas macrophages coordinate cell-mediated and innate immunity. C. albicans infections alter the Th1/Th2/Th17 immune balance and systemic cytokine and chemokine expression. Virulent candidemia induces Th2 subset activation, thereby suppressing the Th1 subset and increasing susceptibility to infection [7,8]. Conversely, resistance to C. albicans infection can be achieved by Th1/Th17 directed cell-mediated immunity. Th17 differentiation protects against disseminated candidiasis [9]. CD47 is a unique Ig superfamily member that is expressed on many cell types [10,11]. CD47 is a transmembrane receptor that mediates self-recognition, preventing clearance by phagocytic cells, which recognize CD47 via the counter-receptor SIRP [12]. Several viruses encode cell surface proteins similar to CD47 that enable infected cells to evade host immunity by engaging SIRP [13]. Similarly, elevated CD47 expression by some cancers protects them against natural killer (NK) cells, macrophage clearance, and antibody-dependent tumor cell killing [1416]. A second function of CD47 is to support cell migration via its interactions with a subset of integrins and with SIRP [11]. CD47 expression on leukocytes and endothelium is thereby critical for immune cells to localize to a site of infection [11,17] and for T cell activation [18]. Blocking surface CD47 using monoclonal antibodies significantly reduced polymorphonuclear (PMN) leucocyte transmigration through collagen coated filters [19]. cd47-/- mice are more susceptible to gram negative bacterial infections due to delayed neutrophil recruitment and a weakened integrin-dependent oxidative burst response [2022]. Furthermore, E. coli K1 upregulated CD47 on dendritic cells in a mouse meningitis model, thereby increasing tolerance to infection [23]. In contrast, cd47-/- mice are less susceptible to developing Staphylococcus aureus-induced arthritis [24] and to LPS-triggered acute lung injury and E. coli pneumonia. PMN recruitment in cd47-/- mice was not impaired in zymosan-induced peritonitis [25], suggesting that recruitment in response to fungal pathogen-associated molecular patterns (PAMPs) does not depend on CD47. The third important function of CD47 in immunity is to serve as a receptor for the matricellular protein thrombospondin-1 (TSP1). TSP1 binding to CD47 inhibits T cell activation [26 28] and nitric oxide signaling in T cells [29] and increases T cell differentiation into Treg cells [30]. TSP1 signaling via CD47 also inhibits dendritic cell activation, survival, and IL-12 production [3133]. We recently reported that thbs1-/- mice are more resistant to local and disseminated candidiasis [34]. Resistance was associated with more rapid clearance of kidney colonization, enhanced macrophage phagocytosis of C. albicans, and a more balanced inflammatory cytokine response. TSP1 utilizes several signaling receptors on innate and adaptive immune cells [27,35], so the role of CD47 in mediating these effects of TSP1 on C. albicans pathogenesis is unclear. Based on its known immune functions, CD47 could play both protective and sensitizing roles in fungal infections. Because antibodies that block CD47 are entering clinical trials for treating cancer patients [36], it is important to know whether this treatment could increase their susceptibility to disseminated candidiasis. We show that, in contrast to its ligand TSP1, CD47 supports protective immunity against disseminated candidiasis in a mouse model by limiting host pro-inflammatory cytokine/chemokine expression and by limiting neutrophil infiltration. Materials and Methods Ethics statement Experimental protocols, housing, and care of mice were conducted in an AAALAC approved facility according to animal study protocol LP-022 approved by the National Cancer Institute Animal Care and Use Committee. Strains and growth conditions For challenge of mice, C. albicans strain SC5314 [37] was grown overnight in 50 mL of Yeast Peptone Dextrose (YPD) medium at 30C with aeration as previously described [38]. Cells were harvested by centrifugation at 3,000 g for 10 min, washed twice with 50 ml of sterile nonpyrogenic normal saline (Quality Biological Inc., MD), and resuspended in 10 ml of saline before quantification using a Petroff-Hausser counting chamber. The cell suspensions were adjusted to the final concentration for parenteral administration using non-pyrogenic sterile saline. Mouse infection with C. albicans Inbred 8 to 12 week old (2025 g) wild type (WT) and cd47-/- mice on a pure C57BL/6J background (The Jackson Laboratory) were bred in a NCI vivarium and used for all animal experiments. cd47-/- mice were periodically back-crossed against WT to minimize phenotypic drift. Mice were randomly allocated to groups of five animals per cage and provided ad libitum access to filtered water and standard mouse chow. Each group of mice was inoculated intravenously in the lateral caudal tail vein using a 30 gauge needle with a volume of 0.1 ml of saline containing 5x105 C. albicans cells [38,39]. Clinical signs of illness in each mouse were evaluated three times daily, and mice displaying arched backed posture, sunken eyes, ruffled hair or dehydration were euthanized immediately by CO2 inhalation and processed for complete necropsy and collection of tissues for histopathological examination. To examine virulence in the absence of CD47, we used 810 mice per group. As controls we used WT and cd47-/- mice administered with 0.1 ml of non-pyrogenic sterile saline (n = 5 per group). To longitudinally monitor effects of CD47 on organ burden and host immune responses, mice infected with C. albicans were euthanized sequentially from 1 to 6 days post-inoculation (PI). A total of 18 mice from each strain were inoculated with SC5314, and 3 control mice received no fungal challenge. Three animals from each group were sacrificed daily from day 1 to day 6 PI for histopathology and cytokine assays. The 3 control animals, i.e., untreated and uninfected, administered with 0.1 ml of non-pyrogenic sterile saline were sacrificed, and the organs and serum were collected. The mean results for these 3 control animals were used as time zero values. Sera were stored at 80C until analysis. Flow cytometric analysis was used to quantify the inflammatory response in spleens, kidneys and brains from WT (n = 5) and cd47-/- (n = 5) mice at day 1, 2, 3, 4 and 7 PI with C. albicans as compared with uninfected control mice. The same experiment was reproduced twice. We analyzed leukocytes infiltration in these tissues at same PI intervals using at least 4 mice per group. Necropsy and histopathology Immediately after euthanasia, macroscopic changes were recorded, and the brain, heart, lungs, liver, spleen, and right kidney were immersed in buffered 10% formalin, processed for paraffin embedding, sectioned at 5 m, and stained with H&E. Grocotts modification of Gomoris methenamine silver (GMS) stain was used for detection of fungi in situ [40]. Inflammatory reactions were scored between ++++ for severe inflammation with PMN infiltration and + for localized inflammatory foci. Histopathology images from sections of formalin-fixed and paraffin-embedded tissues stained with Gomori's methenamine silver or H&E were obtained using a light microscope (Olympus BX51) fitted with a digital camera (Nikon DXM1200F) and ScanScope XT digital scanner (Aperio). Images were processed with Adobe Photoshop and Aperio ImageScope v11.1.2.760 (Aperio). Organ burden quantification Three mice from each group were euthanized at day 1, 4 and 7 PI to determine the fungal burden in their kidneys. After sterile isolation, kidneys were weighed and homogenized in 1.0 ml of nonpyrogenic sterile saline. 10 fold serial dilutions of 102, 104 and 106 in 0.1 ml of the homogenates were spread on triplicate on plates containing Nickersons medium, also known as BiGGY agar, a selective and differential medium for C. albicans [41]. After 48 h of incubation at 30C, colony number, morphology, and color were recorded, and numbers of CFU per kidney were estimated. C. albicans appears as brown to black colonies with no pigment diffusion and no sheen [41]. Determination of serum cytokines and chemokines Serum was collected from sacrificed mice at various time points following infection with C. albicans in WT and cd47-/- mice. A Luminex bead array Milliplex MAP Kit (catalog no MPXMCYTO-70K, Millipore, Billerica, MA) was used to quantify cytokines including IL-4, IL-6, IL-10 IL-17, and TNF-, according to the manufacturer's specifications. Mononuclear cell isolation Single cell suspensions from brain and kidney were prepared after intracardiac perfusion of anaesthetized mice with 20 ml of normal saline to remove the circulating blood lymphocytes. Brain tissues were incubated with 1 ml of collagenase D (1 mg/ml; Roche) at 37C for 30 min followed by mechanical disruption of the organs through a 100 m filter. The homogenates were resuspended in 4 ml of 90% Percoll (GE Healthcare) in HBSS, and a gradient was prepared by overlaying 3 ml of 60% Percoll, 4 ml of 40% Percoll and 3 ml of HBSS respectively. The gradients were then centrifuged at 1,700 rpm for 18 min at 4C, after which the band corresponding to mononuclear cells was isolated, and single cell suspensions were washed with HBSS and then resuspended in RPMI 1640. Kidney tissues were mechanically disrupted with a 100 m filter, after which the homogenates were resuspended in 8 ml of 40% Percoll, and gradients were prepared by overlaying the cell suspension on top of 70% Percoll (3 ml) in 15 ml tubes [42]. The gradients were centrifuged at 2,000 rpm for 30 min at 4C, after which the band of mononuclear cells present at the 70%40% interface was isolated and subsequently washed to make single cell suspensions. In all cases, the absolute number of mononuclear cells from each organ was determined prior to flow cytometry analysis. Splenocytes were prepared by mechanical disruption of spleens on 100-m filters, after which the cells were treated with red blood cell lysis buffer (0.14 M NH4Cl and 0.017 M Tris-HCl, pH 7.2), and washed twice before staining. In all cases, the absolute number of mononuclear cells from each organ was determined prior to flow cytometry analysis. Mononuclear cells isolated from different organs were blocked with 3.3 g/ml of anti-mouse CD16/CD32 (Fc block; BD Biosciences) in PBS containing 1% FBS for 20 min prior to antibody staining. The following antibodies were used to characterize leukocyte populations: CD45.2-FITC (BD Bioscience Clone 104), CD8-Pacific Blue (Invitrogen, Clone MH10), CD4 Qdot 605 (Invitrogen, Clone RM4-5), CD11b-PE-Cy7 (eBioscience, Clone M1/70), Gr1-APC (BD Bioscience, Clone RB6-8C5), CD11c-APC-Cy7 (Biolegend, Clone N418), Thy1.2 Alexa Fluor-700 (Biolegend, Clone 30/H12), NK1.1 PerCP Cy5.5 (BD Bioscience, Clone PK136), CD4-PeCy7 (Biolegend, GK1.5), and CD45.2-APCy7 (Biolegend, Clone 104). The primary antibody staining was performed for 30 min on ice in 100 l of FACS buffer (PBS containing 1% FBS), the cells were analyzed using flow cytometry (Digital LSR II; BD), and the data were analyzed using FlowJo software (Tree Star, Inc). For intracellular flow cytometry (IC flow) experiments, splenocytes were harvested from cohorts of WT and cd47-/-control and infected mice at 7 days PI. Single cell suspensions of splenocytes were stimulated with PMA/ionomycin (Sigma) for 2 h at 37C followed by 2 h incubation in the presence of Golgi stop and Golgi plug (BD bioscience). Intracellular staining was performed to measure cytokine profiles of T cells from non-infected and infected mice. Briefly, splenocytes were treated with fixation buffer (eBioscience) for 30 min and then washed twice with permeabilization buffer. Cells were then stained with CD4-PE-cy5 (RM4-5), IL4-FITC(11B11), IL17-APC (eBio17B7), IFN-PE (XMG1.2), and Foxp3-PB (MF-14), incubated at 4C for 30 min, washed, resuspended in PBS+0.1% BSA+0.01% azide and analyzed using LSR II and FACS Diva software. Collagen deposition analysis To estimate levels of fibrosis, unstained 3 m-thick kidney sections obtained from paraffin blocks were deparaffinized, rehydrated, and placed in 0.2% phosphomolybdic acid for 2 min to reduce nonspecific staining. Sections were stained with 0.1% Sirius red (Polysciences Inc., Washington, DC) in saturated aqueous picric acid for 1 h and dipped in 0.01% HCl for 30 s for differentiation. The slides were immediately dehydrated and mounted with cover slips. Collagen fraction was determined by measuring the area of stained tissue with Quantitative Morphometric analysis. Three representative micrographs at 200x magnification of each mouse Sirius red stained kidney sections were analyzed within a given field, expressing that area as a proportion of the total area under observation using Adobe Photoshop. Each time point represents the average of nine micrographs of Candida colonized kidneys. A threshold grey level for stained collagen was calculated as a percentage to total area [43]. ELISA for anti-mannan IgM Wells of 96-well microplates were coated with 50 l of anti-mouse IgM in DPBS (for standard curve) or mannan (Sigma) at 25 g/ml in 100 mM sodium carbonate, pH 9.2, and incubated overnight at 4C. Plates were washed three times with 200 l of DPBS/0.05% Tween-20 and blocked with 1% BSA/DPBS at room temperature for 30 min. After washing, plates were incubated overnight at 4C with 100 l of sera diluted 1/100 in 1% BSA/DPBS. After washing, the plates were incubated with 100 l/well of 2 g/ml biotinylated anti-mouse IgM (R6-60.2) at RT for 1 h. The plates were washed six times and then incubated with 100 l of 1/1000 dilution of avidin-HRP in 1% BSA/DPBS at RT for 30 min. After washing six times, 50 l/well of OPD (ophenylenediamine, Sigma) in 0.05 M phosphate-citrate buffer/0.03% sodium perborate pH 5 were added. After 710 min incubation, color development was stopped by addition of 100 l per well of 3 M sulfuric acid, and the optical density was measured at 490 nm. BMDM culture and phagocytosis and viability assays To make primary bone marrow-derived macrophages (BMDMs), age- and gender-matched mice were sedated using isoflurane and euthanized with cervical dislocation. All hind leg bones were removed, cleaned of all tissue and sterilized with 70% ethanol. Femurs and tibias were flushed with RPMI II supplemented with L-Gln. Red blood cells were lysed with ACK Lysis Buffer. Cells were plated and differentiated into macrophages using 30% L929 conditioned medium in RPMI supplemented with L-Gln, Pen-Strep, and 10% FBS as described previously [44]. L929 cells were a kind gift from Dr. Alan Sher, NIH. BMDMs were lifted using EDTA, counted and plated. The phagocytosis assay was adapted from a published method [45]. Briefly, differentiated BMDMs from wild type and cd47-/- mice were incubated in OptiMEM for 2.5 h and lifted with EDTA. Macrophages were added to polypropylene tubes (USA Scientific) containing 0, 0.5, 1, or 5 multiplicity of infection (MOI) of either wild type or GFP+ C. albicans strain SC5314 (provided by Dr. Judith Berman) [46] in OptiMEM, and incubated with shaking for 15 min or 30 min as indicated. Unbound yeast were washed from the BMDM using ice cold FACS Buffer (PBS containing 3% fetal calf serum), and the remaining cells and yeast were stained with antiCandida primary antibody (AbCam, ab53891) and secondary goat anti-Rabbit APC (Invitrogen). Fluorescence was detected using a BD LSR II flow cytometer and analyzed with FlowJo (Tree Star Inc). Cell viability was assessed by lactate dehydrogenase (LDH) release following manufacturers instructions (Promega). For the in vitro killing assay hind leg bones from WT (N = 4) and cd47-/- (N = 4) mice were removed and flushed with cold HBSS+0.5% BSA+2 mM EDTA. Red blood cells were lysed with ACK lysis buffer. Neutrophils or macrophages were isolated by negative selection using neutrophil and macrophage isolation kits (Miltenyi Biotec) following the manufacturers instructions. In short, cells were incubated with depleting biotin-antibodies, followed by magnetic anti-biotin beads and magnetic separation. Macrophages were grown for 3 days in DMEM/ F12 supplemented with L-Gln, Pen-Strep, 10% FBS, and 10 nM mouse recombinant M-CSF (eBioscience). Before inoculation, neutrophils or macrophages were washed 3x in serum-free RPMI and plated in a 96 well plate. Neutrophils or macrophages were inoculated with 1x105 C. albicans in serum-free RPMI in duplicate. After 4 hours, a serial dilution of the cells was plated on YPD plates for 30 h at 30C in duplicate. The colonies formed were counted and compared to the non-inoculated control. Inflammatory gene expression Inflammatory gene expression analysis was done in WT and cd47-/- mice at day 3 PI. Specific mRNA levels in total kidney and spleen RNA were analyzed by NanoString methodology as previously reported [47,48] and conducted at the DNA sequencing core facility of NIH. Briefly, 100 ng of total RNA per kidney were hybridized to the target specific mouse inflammatory TCACAGAAGTGGACGGAGTG GTCAATGTGTGTCCCGACTG ACGCAGGCAAAACACTCATA AACATCAGGCAGAATCCCTCT CCTACCAGGAAATCTCGAAGAC TCATCTTGTCTTGGCTGGTG TGGGGATGTCTTTCCTTCAC TCGTTTCTCAAGCCAATTCC ACCAACCATCACGACTCCTC gene CodeSet at 65C. The CodeSet contained probes against a panel of 179 genes encoding proteins involved in mouse inflammation and six internal reference genes and were used to analyze local inflammatory response in kidneys. The hybridized reactions were loaded onto the NanoString Prep station, which removes excess reporter, binds the reporter to the cartridge surface, and stretches the probes for scanning. Subsequently, the cartridges were loaded onto the NanoString Digital Analyzer and scanned. This method provides a quantitative analysis of gene expression [4951]. Complete primary data is available in S1 Data. qRT-PCR was used to validate selected NanoString data, using at least three mice per replicate. Primers used for qRT-PCR are listed (Table 1). The Excel-based method described by the manufacturer or the delta-delta Ct method was used to perform normalization compared to six internal controls and basic statistical analysis of the data. The normalized results are expressed as the relative mRNA level, and values for infected WT and cd47-/- kidneys were averaged and shown as mean s.d. Statistical significance was calculated using Student's t test with significance as p<0.05. Using Genego software in MetaCore [48], up- and down-regulated genes clusters were analyzed for significant pathways. The probability of survival as a function of time was determined by the Kaplan-Meier method, and significance was determined by the log-rank (Mantel-Cox) test and Jehan-Breslow-Wilcoxon test using GraphPad Prism software. Serum cytokine expression patterns and flow cytometry data among all treatment groups at various time points were analyzed by two-way ANOVA with post Bonferroni comparison test. Three to 4 randomly selected mice from each group were euthanized at each time point for longitudinal comparisons. Data were analyzed for significant differences by comparing means of each triplicate reading at various time points assuming that the cytokine expression levels within each group of mice are normally distributed [52]. Collagen fraction was analyzed using Students t test. Intracellular flow cytometry analysis was done by using unpaired Student t tests. An initial experiment using 8 mice per group showed that WT mice infected with 5x105 C. albicans had significantly higher survival compared with infected cd47-/- mice (p <0.002, hazard ratio estimate of 9.0 with 95% confidence interval 2.236.6). These results were reproduced in a second experiment with 15 mice per group (hazard ratio estimate of 7.1 with 95% confidence Fig 1. cd47-null mice are more susceptible to disseminated Candida infection. (A). Each group consisted of fifteen 812 week old female mice. Mice were administered 5x105 cells through the lateral tail vein. Results were analyzed using log-rank (Mantel-Cox) test and Jehan-Breslow-Wilcoxon test. (B). Kidneys of mice infected with C. albicans. WT mice did not show gross lesions, whereas CD47 null mice showed enlarged mottled kidneys with superficial micro-abscesses. (C). Kidney fungal burdens of mice infected with C. albicans SC5314 strain. Solid bars represent mean CFU of infected left kidney homogenates of cd47-/mice determined by CFU on BiGGY agar from six representative serial dilutions from each kidney, representing five mice per time point infected. Open bars represent mean SE, n = 3, for WT mice infected with C. albicans and were analyzed using two-way ANOVA with post Bonferroni comparison test. interval 2.123.4, P <0.001, Fig 1A). cd47-/- mice inoculated with C. albicans died as early as 4 day post-infection (PI) and suffered 100% mortality by 14 days PI. Infected WT mice did not die until 7 day PI, and 60% survived at the end of the experiment on day 14 PI. Control mice administered with intravenous saline alone had no mortality (data not shown). CD47 alters pathogenesis of candidiasis in kidney and brain Kidney is the primary initial colonization site in disseminated candidiasis. We observed striking difference in gross pathology in the kidneys of infected mice. cd47-/- mice had enlarged kidneys compared with the WT during the entire course of infection except day 1 PI. Fig 1B shows a representative picture at day 4 PI, where infected cd47-/- kidneys were twice as large as infected WT, suggesting more edema and inflammation. In a longitudinal study, CFU in the kidney was comparable in WT and cd47-/- mice at day 1 PI but significantly higher in cd47-/- mice at days 4 and 7 PI (p <0.001 and 0.0001 respectively, Fig 1C). Inflammatory response and fungal colonization was further assessed using H&E and fungal-specific GMS stained sections (Fig 2). Histopathological examinations did not show differential colonization by C, albicans or immune responses until 4 days PI. At 4 days PI cd47-/kidneys exhibited an increased inflammatory response. Representative kidney sections show similar extent and distribution patterns of C. albicans colonization and inflammatory response at 2 days PI (Fig 2A). Consistent with the CFU data in Fig 1, C. albicans colonization became greater at 4 days PI in the cd47-/- mice compared to wild type (Fig 2B). cd47-/- mice had more progressive colonization in kidneys compared with the WT mice. C. albicans broadly colonized the kidneys of cd47-/- mice, whereas WT mice had focal colonization (Fig 2A and 2B GMS sections). Inflammatory changes assessed on H&E sections followed a similar pattern (Fig 2A and 2B H&E sections). The kidneys of cd47-/- mice showed more abundant immune cell infiltration and tissue necrosis. At later times, we consistently observed increased inflammation in the kidneys of cd47-/- mice (data not shown). The pattern of colonization in the brain mirrored that observed in kidneys, with C. albicans disseminating more broadly in brains of cd47-/- mice (Fig 2C & 2D). However, in contrast to kidneys, we did not notice major inflammatory changes in the brains of cd47-/- mice (Fig 2C and 2D H&E sections). Interestingly, WT brains showed very little colonization of C. albicans associated with local inflammatory reactions. Overall, cd47-/- mice exhibited more fungal invasion and colonization in both kidney and brain, but inflammatory reactions differed in these organs. CD47 alters serum cytokine responses during systemic candidiasis To examine systemic responses underlying the increased inflammatory responses in cd47-/mice, we quantified several serum cytokines associated with innate immune responses, up to 4 days PI, when cd47-/- mice started to die (Fig 3A). Consistent with the inflammatory responses and colonization, through 3 day PI we found no significant changes in serum cytokines between the two groups. At day 4 PI, TNF was significantly increased in cd47-/- mice (p <0.001). Increases in serum IL-6 (p < 0.001) and IL-10 (p < 0.001) levels were also observed in cd47-/- mice. However, IL-17 levels were significantly reduced in cd47-/- mice compared with WT at day 4 PI (p < 0.001). These changes at day 4 PI could be consequences of the divergence in colonization at this time point. CD47 does not affect early humoral immunity to C. albicans To determine the impact of CD47 on early humoral immunity, we measured mannan-specific IgM levels in serum at different time points PI (Fig 3B). No significant differences in antimannan levels were observed between WT and cd47-/- mice at any time point up to 6 days PI. These data suggest that CD47 deficiency does not influence early humoral immunity to C. albicans. Fig 2. Kidneys and brains of cd47-/- mice infected with C. albicans show increased fungal colonization and inflammatory responses. (A & C) Representative GMS-stained sections of mouse kidney and brain tissue to detect C. albicans colonization (black) and H&E stained sections to show inflammatory reactions in cd47-/- kidneys compared with the WT at day 2 PI. (B & D) Comparative histopathology of mice with disseminated candidiasis at 4 days PI. Kidney and brain tissues were stained using GMS to detect C. albicans colonization (black) and H&E to assess inflammatory reactions. cd47-/- kidneys showed higher fungal colonization and more inflammation. cd47-/- brains showed higher fungal colonization at both time points. Fig 3. Inflammatory responses in WT and cd47-/- mice associated with disseminated candidiasis. (A) Cytokine levels were compared in mouse sera at the indicated times post inoculation. 4 days PI is the crucial time for cd47-/- mouse mortality at this inoculation dose. This point is associated with higher TNF, IL-6 and IL-10 and lower IL-17. Protection against candidiasis in WT mice is associated with higher IL-17 and lower TNF, IL-6 and IL-10. (B). Mannan-specific IgM levels in sera from infected WT and cd47-/- mice. (C).Collagen staining with Sirius red to assess the level of fibrosis in Candida infected kidneys. cd47-/- mice show more fibrosis, consistent with increased kidney failure. Bars represent mean SE morphometric quantification for nine representative sections from three mice of each group and analyzed using two-way ANOVA with post Bonferroni comparison test for A and B and Students t test for C. CD47 controls kidney fibrosis in disseminated candidiasis We examined renal interstitial collagen deposition to measure the level of fibrosis in infected kidneys. Infected cd47-/- mice (Fig 3C) showed more Sirius red staining compared with the WT kidneys. Quantitative analyses of representative micrographs showed a 3.0-fold increase in the interstitial collagen volume fraction in C. albicans infected cd47-/- versus WT kidneys (Fig 3C, In order to confirm our histopathology data, we conducted quantitative analysis of mononuclear cell infiltration into brains and kidneys by flow cytometry. At day 1, 2, 3, 4 and 7 PI, we quantified neutrophils, macrophages/monocytes, and T cells in the brains and kidneys of infected WT vs cd47-/- mice. No significant differences were found at day 13 PI (data not shown). As expected, at day 4 PI, a statistically significant increase (p<0.05) in neutrophils and macrophage/monocyte/DC populations were observed in the kidneys of cd47-/- mice when Fig 4. Elevated infiltration of innate immune cells into kidney and brain of infected cd47-/- mice. (A) Representative FACS plots showing mononuclear cells infiltration into infected kidney at day 4 PI. Neutrophils are shown on the top circular compartment gated on CD45.2+, Thy1.2-ve, CD11b+, Gr1+ and Ly6c+ markers and macrophage, monocytes and dendritic cells in the lower compartment gated on CD45.2+, Thy1.2-ve, CD11b+, Gr1-ve and Ly6c+ markers. (B) Bar graph shows the percentage of infiltrated immune cells at day 4 in candida infected kidney. (C) Bar graph shows infiltrated immune cells in kidney at day 7 PI (n = 5). (D) Representative FACS plot showing T cells (CD45+ and Thy 1.2+) infiltration in the brain of candida infected animals measured at day 7 PI. The right bar graph shows the percentage of neutrophils (n = 5). Results from 5 mice per group are presented with SE and analyzed using two-way ANOVA with post Bonferroni comparison test. compared to WT controls (Fig 4A and 4B). At day 7 PI neutrophil infiltration trended higher in infected cd47-/- mice (Fig 4C). A similar analysis of brain cells showed no differences at days 1 to 4 PI. However at day 7 PI, infected cd47-/- brains showed significantly higher neutrophil infiltration (p <0.05, Fig 4D). No differences in the numbers of CD8+ and CD4+ T cells were observed between the groups (data not shown). The increased late neutrophil infiltration is consistent with the histopathological findings observed in tissues obtained from infected cd47-/- mice (Fig 2). CD47 does not regulate macrophage phagocytic activity or viability The above results show increased kidney colonization in cd47-/- mice beginning at day 4 PI that occurs despite more accumulation of innate immune cells in this infected organ, which suggests that the absence of CD47 could cause a defect in the phagocytic activity or viability of Fig 5. CD47 does not affect macrophage viability, phagocytosis or attachment of Candida albicans. Wild type and cd47-/- bone marrow was harvested from mice. Bone marrow derived macrophages (BMDMs) were isolated and differentiated. C. albicans endogenously expressing GFP was incubated with WT and cd47-/- BMDMs. Flow cytometry was performed to measure the (A) percent GFP+ BMDMs and (B) mean fluorescence intensity (MFI) of GFP. Anti-Candida antibody indirectly conjugated to APC was used to stain C. albicans attached to the outside of BMDMs. (C) Percent of BMDMs expressing APC and (D) MFI of APC was measured. GFP- strain of Candida albicans was used to calculate background noise and basal fluorescence. (E) BMDM death caused by incubation with C. albicans was assessed by release of LDH at the indicated multiplicities of infection (MOI). LDH release from C. albicans was minimal under these conditions. Experimental data is representative of 3 independent experiments. (F) Killing of C. albicans by macrophages and neutrophils isolated from WT and cd47-/- mice. Results are presented as the percent surviving C. albicans after 4 h as assessed by colony forming units (mean SEM, n = 4). Significance was analyzed by ANOVA. these cells in the presence of C. albicans. To address these questions we assessed phagocytic activity of BMDM from WT and cd47-/- mice (Fig 5A and 5B). WT and cd47-/- BMDM had similar abilities to phagocytose GFP-expressing C. albicans as assessed by flow cytometry. The smaller number of C. albicans bound to the surface of the BMDM did not differ between WT and cd47-/- cells (Fig 5C and 5D). The ability of C. albicans to kill macrophages was assessed by LDH release and did not differ between WT and cd47-/- BMDM (Fig 5E). Control experiments verified that lysis of C. albicans by the BMDM did not contribute significantly to the LDH signal. Therefore, the increased kidney colonization in cd47-/- kidneys is probably not caused by a defect in the phagocytic activity or viability of cd47-/- macrophages in the presence of C. albicans. To determine whether neutrophil or macrophage killing of C. albicans is impaired in the absence of CD47, BMDM and neutrophils purified from bone marrow were assessed for killing of C. albicans in vitro (Fig 5F). No significant differences from killing by the respective WT BMSM or neutrophils were observed. Enhanced Th2, Th2 and Th17 responses in infected cd47-null mice Intracellular flow cytometry was performed to measure Th cell subsets in the effector CD4+ T cell population from spleens of infected and uninfected mice. Th1, Th2 Th17 and Treg induction did not differ at days 1 to 4 PI. However, at day 7 PI representative flow plots (Fig 6A), and a quantitative analysis (Fig 6B) revealed significant increases in Th1, Th2, and Th17 subsets in the infected cd47-/- mice. The percentage of Th1 cells producing IFN was significantly higher (p<0.01) in infected cd47-/- mice. Similarly, CD4+ cells expressing the Th2-specific marker IL-4 were significantly higher (p<0.05) in infected cd47-/- mice. Infected cd47-/- mice also had significantly more (p<0.01) IL-17+ T cells. In contrast, the Foxp3+ T cell populations did not differ between infected cd47-/- and WT mice (Fig 6). T helper cell subsets did not differ between uninfected WT and cd47-/- mice (data not shown). CD47 alters inflammatory gene expression in kidney and spleen To gain further insights into the mechanism by which CD47 alters local and systemic immune responses induced by C. albicans infection, we examined differential gene expression in infected kidneys at 3 days PI to profile a local immune response and in spleens to profile systemic immune response [53]. Of the 193 inflammatory genes tested on the NanoString panel, 18 in spleen and 19 in kidney achieved significance comparing infected cd47-/- versus WT (>1.5-fold change with p <0.05, Table 2, S1 Data). In a separate experiment, we validated our initial gene expression profile by confirming expression patterns of selected genes identified in the NanoString analysis in noninfected WT and cd47-/- vs infected WT and cd47-/- spleens and kidneys (Fig 7). Of the chemokines examined in spleen, Cxcl2 (MIP-2) and Cxcl3 (MIP-2) exhibited the highest fold increases in infected cd47-/- vs. WT, while IL-10, C7 (Cxcl10) and Mef2b (myocyte enhancer factor 2B) recorded more than 4-fold increases. Ccl8 (monocyte chemoattractant protein-2) expression was also increased more than 3.5-fold. cd47-/- kidneys also showed over-expression of Csf3 (G-CSF), Csf2 (GM-CSF), Map3k9 (mitogen activated protein kinase kinase kinase 9) and IL23r, whereas Ccr2 (MIP-1 alpha receptor) and chemokine (C-C motif) ligand 21b (serine) were notably down-regulated in these animals (Table 2 and Fig 7). To better understand the biological functions affected by these alterations in gene expression, pathway analysis was conducted using MetaCore software. The pathway that achieved the highest significance in spleen was the IL-1 response pathway (Table 3). IL-1, IL1R1 and Jun (transcription factor AP-1) were up- regulated in the IL-1 pathway. We further examined local regulation of the IL-1 pathway in infected kidneys by assessing mRNA levels for IL1 and components of the inflammasome pathway involved in its activation (Fig 8). cd47-/kidneys 4 days PI showed significantly elevated mRNA levels for NLRP3 and decreased levels of NLRC4. IL-1 mRNA was elevated in 3 of the 7 infected kidneys but did not achieve significance for the sample group. Other inflammasome-associated mRNAs including AIM2, NOD2, caspase-1, Naip5, NLRP1, and ASC did not show significant changes in infected kidneys at this time point. Fig 6. Th subset expansion in spleens of cd47-/- and WT mice infected with C. albicans. Intracellular flow cytometry was performed on splenocytes at day 7 PI. Splenocytes were stimulated with PMA/ionomycin, and cytokine profiles were measured by five color multi-parameter flow cytometry. (A) Representative flow plots of CD4+ T cells from spleens of C. albicans infected WT vs cd47-/- mice analyzed for intracellular IFN, IL-4, Il-17 and Foxp3 expression. Uninfected WT and cd47-/- mice showed no difference in expression (data not shown). (B) Cumulative bar graph presenting the percentages of Th1 (IFN+), Th2 (IL-4+), Th17 (IL-17+), and Treg (Foxp3+) CD4+ T cells in infected WT and cd47-/- mice. Results from 5 mice per group were analyzed using two-way ANOVA with post Bonferroni comparison test. Fig 7. Effect of CD47 on inflammatory gene expression induced by candidemia. mRNA abundance was determined by qPCR using cDNA synthesized from total RNA of spleens and kidneys. Uninfected WT and cd47-/- mice were compared with the infected WT and cd47-/- mice. Each group had at least three mice. Cxcl2, IL-10 and Fos expression in spleens were significantly up-regulated in infected CD47 mice compared with the WT infected mice (p> 0.001, .01 and 0.01 respectively). CCR2 and TRAF 2 of infected cd47-/- kidney tissues were significantly down-regulated compared with the infected WT mice, while IL23R was significantly up regulated in infected cd47-/- mice (p> 0.001, 0.05 and 0.01 respectively). Results from three mice per group were analyzed using two-way ANOVA with post Bonferroni comparison test. Pathway analysis of the data in kidney indicated more local up-regulation of the Th17 pathway and down-regulation of apoptosis and survival signaling in immune cells involved in the inflammatory changes in infected cd47-/- mice (Table 3). Signaling between antigen presenting cells and activated CD4+ and CD8+ through CD137 achieved the highest score. The second most significant pathway that differed in infected cd47-/- kidneys involves cytokine production by Th17 cells. G-CSF (Csf3), GM-CSF (Csf2), GCP2 (Cxcl5) and IL-23 receptor were up-regulated (Table 2). The transcription factors C/EBP, Fos and Jun are involved in IL-17 signaling and were correspondingly up-regulated in infected cd47-/- spleens (Table 2). Apoptosis and survival signaling via lymphotoxin-beta receptor was the third most significant in kidney gene expression. TRF2, MAP3K5. MAP3K1 and CCL21b were down regulated in this pathway Genes with >1.5-fold difference in mRNA expression between infected cd47-/- and WT tissues and P-values <0.05 are shown. FC: fold change in mRNA expression in infected cd47-/- versus WT. In a C57Bl/6J background, cd47-/- mice challenged intravenously with C. albicans exhibited higher and more rapid lethality. As typically occurs in infected humans and WT mice, kidney colonization limited the survival of infected cd47-/- mice. C. albicans infection increases neutrophil infiltration into brain and kidneys in WT mice [53,54]. Initial colonization of kidneys was similar in infected WT and cd47-/- mice but diverged at day 4. At this time, infected kidneys of cd47-/- mice exhibited excessive neutrophil and macrophage/monocyte infiltration as shown by histopathology and flow cytometry, which is consistent with the observed enlargement of these kidneys. Infected cd47-/- kidneys had more fibrosis, indicating more granulation tissue formation, which may be secondary to the increased inflammation [55]. This was surprising because CD47 was reported to promote PMN recruitment into the peritoneum following E. coli challenge [20], and integrin-mediated neutrophil migration [19,21]. Neutrophils also accumulated more in Candida infected cd47-/- mouse brains. Despite increased neutrophil and macrophage recruitment, the cd47-/- kidneys and brains showed more extensive and invasive C. albicans colonization. Thus, in contrast to the previous bacterial infection models, where cd47-/- mice displayed a defect in neutrophil recruitment that compromised survival and an endotheliumdependent defect in neutrophil recruitment induced by TNF [17], we find that CD47 is not necessary for neutrophil recruitment in response to a C. albicans infection. However, the increased neutrophil and macrophage recruitment in cd47-/- mice is not protective, and CD47 has is no intrinsic role in macrophage phagocytic activity for C. albicans. The increased recruitment of innate immune cells at later time points in the infected cd47-/mice is associated with increased fungal burden in these organs, but in the absence of an cd47-/- vs WT spleens 1 Immune response_IL-1 signaling pathway 2 Immune response_IL-17 signaling pathways 3 Immune response_Gastrin in inflammatory response 4 Mucin expression in CF via IL-6, IL-17 signaling pathways 5 Immune response_Oncostatin M signaling via MAPK in mouse cells 6 Immune response_Oncostatin M signaling via MAPK in human cells 7 Transcription_Role of AP-1 in regulation of cellular metabolism 8 Immune response_Human NKG2D signaling 9 Immune response_Murine NKG2D signaling 1 Immune response_CD137 signaling in immune cell 2 Cytokine production by Th17 cells in CF 3 Apoptosis and survival_Lymphotoxin-beta receptor signaling 4 Cytokine production by Th17 cells in CF (Mouse model) 5 Immune response_IL-17 signaling pathways 6 Transcription_Transcription regulation of aminoacid metabolism 7 G-protein signaling_Ras family GTPases in kinase cascades (scheme) 8 Apoptosis and survival_Cytoplasmic/mitochondrial transport of proapoptotic proteins Bid, Bmf and Bim 9 Immune response_Oncostatin M signaling via MAPK in mouse cells 10 Immune response_Oncostatin M signaling via MAPK in human cells P Value 7.6E-8 Statistics are listed for the top ten statistically significant maps based on differential gene expression in cd47-/- versus WT spleens and kidneys generated by MetaCore algorithms. identifiable functional phagocytosis or killing defect in the cd47-/- innate immune cells, additional CD47-dependent immune defects must enable this increased colonization. An IL-17and G-CSF-dependent deficit in granulopoiesis in cd47-/- mice was reported in the colitis model [25], but we observed increased neutrophils and macrophages/monocytes in infected cd47-/- kidneys and neutrophils in infected brains. Independent of effects on recruitment, local expansion of granulocytes in infected cd47-/- kidneys may be driven by the increased G-CSF and GM-CSF expression we observed in this organ. In addition to regulating phagocytic activity by engaging its counter receptor SIRP [56], CD47 engagement with SIRP on dendritic cells controls their differentiation and half-life [57,58]. SIRP is also expressed on normal kidney podocytes, where its basal phosphorylation is decreased following glomerular injury [59]. Thus, the absence of CD47 to engage SIRP could alter antigen presentation to adaptive immune cells, and signaling between non-immune cells in the kidney. Signaling through SIRP is generally inhibitory, suggesting that loss of this signal could account for the up-regulation of inflammatory gene expression that we observed in spleens and kidneys of infected cd47-/- mice. Our data suggests that a defective adaptive immune response also contributes to the increased susceptibility of cd47-/- mice to candidemia. The role of humoral immunity in controlling fungal infections is still understudied but is generally considered to play a minimal role in disseminated candidiasis [60]. Th2 cells produce cytokines that promote antibody production [61], but we did not observe any CD47-dependent alterations in early IgM response up to day 6 PI. Thus, regulation of early humoral immunity is not a major function of CD47 in candidemia. Fig 8. Effect of CD47 on inflammasome pathway gene expression in infected kidney. RNA was purified from kidneys of infected WT and cd47-/- mice at 4 days PI. cDNA synthesis was performed, and primers to NLRP3, NCLR4, IL1b, AIM2, NOD2, Caspase-1, Naip5, NLRP1, and ASC were used to quantify mRNA expression levels and normalized to HPRT expression. Each mouse is plotted as individual point, and standard error mean is indicated with a horizontal line. Students t test was used to calculate significant (p<0.05) and indicated (*). CD47 is highly expressed on peripheral T lymphocytes and, depending on the context, can be a co-stimulator or inhibitor of T cell activation [21,26,28,6264]. The present study suggests that CD47 plays a protective role against disseminated candidiasis through regulation of T helper cell differentiation and expression of cytokines that modulate this differentiation. Susceptibility to candidiasis in mice was previously associated with activation of the Th2 subset and IL-10 production [7,65]. Infection of WT mice by a virulent strain of C. albicans typically mRNA [4]. Significant differences in serum cytokine responses to disseminated candidiasis were observed in cd47-/- mice showing severe clinical signs at day 4 PI. Infected cd47-/- mice levels compared with infected WT. This is consistent with a previous report of diminished serum IL-6 and IL-17A levels in cd47-/- mice in a dextran sulfate-induced colitis model [25]. Lower IL-17 is also consistent with a diminished Th17 response reported in cd47-null mice exposed to trinitrobenzene sulfonic acid in a colitis model [66]. The same group subsequently showed that treatment with CD47-Fc conferred protection via a Th17-dependent mechanism [67]. Consistent with these data, a recent study by a different group found decreased numbers of Th17 cells in healthy intestinal mucosa of cd47-null and SIRP signaling-deficient mice, and a corresponding defective Th17 response to Citrobacter infection [68]. In this context, our data indicates that a defective Th17 response may contribute to the decreased resistance of cd47null mice to C. albicans. Despite these changes in serum cytokines, analysis of splenic Th cell subsets at day seven indicates that, as the disease progresses to a chronic stage, cd47-/- mice infected with C. albicans produce elevated Th1, Th2 and Th17 T cell subsets without altering T reg. This hyper-T cell inflammatory response is not protective and is consistent with the prolonged oxazolone-induced inflammation reported in cd47-/- mice [69]. Interaction between CD47 and BNIP3 induces T cell apoptosis, and the absence of CD47 was reported to prevent termination of a T cell inflammatory response by this mechanism. Systematic analysis using the NanoString technique provides quantitative and sensitive detection of changes in inflammatory gene expression [47,53]. Cxcl2 (MIP-2 ) and cxcl3 (MIP-2 ) mRNAs were over-expressed 24- and 17-fold, respectively, compared with WT in cd47-/spleens at day 3. These CXC chemokine family members are chemotactic factors for PMN and other immune effector cells [70]. In vitro studies indicated that C. albicans induces enhanced levels of MIP-2 [71]. Over-expression of MIP-2 may account for the increased infiltration of inflammatory immune cells into infected cd47-/- kidney and brain, shifting the balance towards a pro-inflammatory milieu. Pathways associated with IL-1, IL-17 signaling and gastrin-mediated inflammatory response were also highly activated in spleens of infected cd47-/- mice. The IL-1 pathway may play a major role in the exaggerated inflammatory response of infected cd47-/- mice. IL-1 is a proinflammatory cytokine produced by activated macrophages, endothelial cells, B cells and fibroblasts, which stimulate a broad spectrum of immune and inflammatory responses. IL-1 & induce cellular responses through the type I IL-1 receptor (IL-1R1) [72]. Our data show that IL-1 and Il-1R1 mRNA are over-expressed together with important transcription factors in the pathway in infected cd47-/- spleens, leading to more pro-inflammatory reactions. Although IL-1 mRNA is not significantly elevated in infected cd47-/- kidneys, local production of active IL-1 may be elevated because NLRP3, which is a critical element of the inflammasome pathway for proteolytic maturation of IL-1, is significantly elevated in infected cd47-/- kidneys. Kidneys of cd47-/- mice infected with C. albicans at day 3 PI up-regulated csf2 or GM-CSF (8-fold), csf3 or G-CSF (4-fold) and IL-23R (5-fold) and down regulated Ccr2 (7-fold) and Ccl21b (4-fold). The pro-inflammatory environment in the cd47-/- mice may be regulated by changes in Th17 signaling, which was also highly significant in our gene expression analysis. Signaling through this pathway induces IL-6, G-CSF, GM-CSF, and (Cxcl5) GCP2, all of which enhance neutrophil recruitment and granulopoiesis [73], consistent with the significantly higher neutrophil infiltration into infected cd47-/- kidneys and brains in this study. Changes in G-CSF, GM-CSF, GCP2, and the serum cytokine IL-6 in our gene expression analysis strongly correlates with the enlarged severely inflamed kidneys of infected cd47-/- mice. Collectively, these data demonstrate that cd47-/- mice are more susceptible to disseminated candidiasis. cd47-/- mice exhibit poorly controlled pro-inflammatory responses to Candida infection. We propose that CD47 is required in the host to mount a balanced protective immune response against candidiasis. The increased susceptibility of cd47-/- mice to C. albicans contrasts with the resistant phenotype of thbs1-/- mice [34]. This suggests that TSP1 receptors other than CD47 play a dominant role in mediating the effects of TSP1 on a systemic C. albicans infection. These findings suggest that CD47 could be a useful molecular target for therapeutic intervention to control fungal infections, but the humanized CD47 antibodies that have recently entered clinical trials may adversely affect the control of candidiasis in cancer patients. S1 Data. NanoString Data. This Excel file contains the complete raw and processed data supporting Tables 2 and 3. Complete gene expression data normalized using internal controls was determined for each of the infected WT and cd47-null spleens and kidneys and is summarized in the data worksheet. Genes are listed in order of decreasing significance determined by ttest. Compiled raw nCounter counts for all of the samples analyzed with positive and negative controls are in the RCC Collection worksheet. Counts for individual samples are in subsequent worksheets. (XLS) This work was supported by the Intramural Research Program of the National Institutes of Health, National Cancer Institute, Center for Cancer Research and the National Institute of Neurological Disorders and Stroke, NIH. We are grateful to Dr. David Soto Pantoja (Laboratory of Pathology, NCI) for guidance on Sirius red staining and Mr. Jason Foley (NCI) for help with the Luminex assays. Conceived and designed the experiments: DHMLPN DN EVS GMM DDR. Performed the experiments: DHMLPN DN EVS ECL-M GMM. Analyzed the data: DHMLPN DN EVS ECL-M GMM. Wrote the paper: DHMLPN EVS ECL-M GMM DDR. 13. Cameron CM, Barrett JW, Mann M, Lucas A, McFadden G (2005) Myxoma virus M128L is expressed as a cell surface CD47-like virulence factor that contributes to the downregulation of macrophage activation in vivo. Virology 337: 5567. PMID: 15914220 32. Johansson U, Londei M (2004) Ligation of CD47 during monocyte differentiation into dendritic cells re sults in reduced capacity for interleukin-12 production. Scand J Immunol 59: 5057. PMID: 14723621 1. Kim J , Sudbery P ( 2011 ) Candida albicans, a major human fungal pathogen . J Microbiol 49 : 171 - 177 . doi: 10.1007/s12275- 011 - 1064 - 7 PMID: 21538235 2. Evans SE ( 2010 ) Coping with Candida infections . Proc Am Thorac Soc 7 : 197 - 203 . doi: 10.1513/pats. 200907-075AL PMID: 20463248 3. Kullberg BJ , Filler SG ( 2002 ) Candidemia . In: Calderone RA, editor. Candida and Candidiasis. Washington, DC.: ASM Press. pp. 327 - 340 . 4. Navarathna DH , Roberts DD ( 2010 ) Candida albicans heme oxygenase and its product CO contribute to pathogenesis of candidemia and alter systemic chemokine and cytokine expression . Free Radic Biol Med 49 : 1561 - 1573 . doi: 10.1016/j.freeradbiomed. 2010 . 08.020 PMID: 20800092 5. Sudbery PE ( 2011 ) Growth of Candida albicans hyphae . Nat Rev Microbiol 9 : 737 - 748 . doi: 10.1038/ nrmicro2636 PMID: 21844880 6. Ashman RB ( 2008 ) Protective and pathologic immune responses against Candida albicans infection . Front Biosci 13 : 3334 - 3351 . PMID: 18508436 7. Romani L ( 1999 ) Immunity to Candida albicans: Th1, Th2 cells and beyond . Curr Opin Microbiol 2 : 363 - 367 . PMID: 10458979 8. Traynor TR , Huffnagle GB ( 2001 ) Role of chemokines in fungal infections . Med Mycol 39 : 41 - 50 . PMID: 11800268 9. Huang W , Na L , Fidel PL , Schwarzenberger P ( 2004 ) Requirement of interleukin-17A for systemic antiCandida albicans host defense in mice . J Infect Dis 190 : 624 - 631 . PMID: 15243941 10. Roberts DD , Miller TW , Rogers NM , Yao M , Isenberg JS ( 2012 ) The matricellular protein thrombospondin-1 globally regulates cardiovascular function and responses to stress via CD47 . Matrix Biol 31 : 162 - 169 . doi: 10.1016/j.matbio. 2012 . 01.005 PMID: 22266027 11. Soto Pantoja DR , Kaur S , Miller TW , Isenberg JS , Roberts DD ( 2013 ) Leukocyte surface antigen CD47 . UCSD Molecule Pages 2 : 1 - 36 . 12. Matozaki T , Murata Y , Okazawa H , Ohnishi H ( 2009 ) Functions and molecular mechanisms of the CD47-SIRPalpha signalling pathway . Trends Cell Biol 19 : 72 - 80 . doi: 10.1016/j.tcb. 2008 . 12.001 PMID: 19144521 14. Kim MJ , Lee JC , Lee JJ , Kim S , Lee SG , Park SW , et al. ( 2008 ) Association of CD47 with natural killer cell-mediated cytotoxicity of head-and-neck squamous cell carcinoma lines . Tumour Biol 29 : 28 - 34 . doi: 10.1159/000132568 PMID: 18497546 15. Jaiswal S , Chao MP , Majeti R , Weissman IL ( 2010 ) Macrophages as mediators of tumor immunosurveillance . Trends Immunol 31 : 212 - 219 . doi: 10.1016/ 2010 . 04.001 PMID: 20452821 16. Zhao XW , van Beek EM , Schornagel K , Van der Maaden H , Van Houdt M , Otten MA , et al. ( 2011 ) CD47-signal regulatory protein-alpha (SIRPalpha) interactions form a barrier for antibody-mediated tumor cell destruction . Proc Natl Acad Sci U S A 108 : 18342 - 18347 . doi: 10.1073/pnas.1106550108 PMID: 22042861 17. Azcutia V , Stefanidakis M , Tsuboi N , Mayadas T , Croce KJ , Fukuda D , et al. ( 2012 ) Endothelial CD47 promotes vascular endothelial-cadherin tyrosine phosphorylation and participates in T cell recruitment at sites of inflammation in vivo . J Immunol 189 : 2553 - 2562 . doi: 10.4049/jimmunol.1103606 PMID: 22815286 18. Reinhold MI , Green JM , Lindberg FP , Ticchioni M , Brown EJ ( 1999 ) Cell spreading distinguishes the mechanism of augmentation of T cell activation by integrin-associated protein/CD47 and CD28 . Int Immunol 11 : 707 - 718 . PMID: 10330276 19. Liu Y , Merlin D , Burst SL , Pochet M , Madara JL , Parkos CA ( 2001 ) The role of CD47 in neutrophil transmigration . Increased rate of migration correlates with increased cell surface expression of CD47 . J Biol Chem 276 : 40156 - 40166 . PMID: 11479293 20. Lindberg FP , Bullard DC , Caver TE , Gresham HD , Beaudet AL , Brown EJ ( 1996 ) Decreased resistance to bacterial infection and granulocyte defects in IAP-deficient mice . Science 274 : 795 - 798 . PMID: 8864123 21. Reinhold MI , Lindberg FP , Kersh GJ , Allen PM , Brown EJ ( 1997 ) Costimulation of T cell activation by integrin-associated protein (CD47) is an adhesion-dependent, CD28-independent signaling pathway . J Exp Med 185 : 1 - 11 . PMID: 8996237 22. Su X , Johansen M , Looney MR , Brown EJ , Matthay MA ( 2008 ) CD47 deficiency protects mice from lipopolysaccharide-induced acute lung injury and Escherichia coli pneumonia . J Immunol 180 : 6947 - 6953 . PMID: 18453616 23. Mittal R , Gonzalez-Gomez I , Prasadarao NV ( 2010 ) Escherichia coli K1 promotes the ligation of CD47 with thrombospondin-1 to prevent the maturation of dendritic cells in the pathogenesis of neonatal meningitis . J Immunol 185 : 2998 - 3006 . doi: 10.4049/jimmunol.1001296 PMID: 20675593 24. Verdrengh M , Lindberg FP , Ryden C , Tarkowski A ( 1999 ) Integrin-associated protein (IAP)-deficient mice are less susceptible to developing Staphylococcus aureus-induced arthritis . Microbes Infect 1 : 745 - 751 . PMID: 10816079 25. Bian Z , Guo Y , Luo Y , Tremblay A , Zhang X , Dharma S , et al. ( 2013 ) CD47 deficiency does not impede polymorphonuclear neutrophil transmigration but attenuates granulopoiesis at the postacute stage of colitis . J Immunol 190 : 411 - 417 . doi: 10.4049/jimmunol.1201963 PMID: 23203922 26. Kaur S , Kuznetsova SA , Pendrak ML , Sipes JM , Romeo MJ , Li Z , et al. ( 2011 ) Heparan sulfate modification of the transmembrane receptor CD47 is necessary for inhibition of T cell receptor signaling by thrombospondin-1 . J Biol Chem 286 : 14991 - 15002 . doi: 10.1074/jbc. M110.179663 PMID: 21343308 27. Li Z , Calzada MJ , Sipes JM , Cashel JA , Krutzsch HC , Annis DS , et al. ( 2002 ) Interactions of thrombospondins with alpha4beta1 integrin and CD47 differentially modulate T cell behavior . J Cell Biol 157 : 509 - 519 . PMID: 11980922 28. Miller TW , Kaur S , Ivins-O'Keefe K , Roberts DD ( 2013 ) Thrombospondin-1 is a CD47-dependent endogenous inhibitor of hydrogen sulfide signaling in T cell activation . Matrix Biol 32 : 316 - 324 . doi: 10. 1016/j.matbio. 2013 . 02.009 PMID: 23499828 29. Isenberg JS , Annis DS , Pendrak ML , Ptaszynska M , Frazier WA , Mosher DF , et al. ( 2009 ) Differential interactions of thrombospondin-1, -2, and -4 with CD47 and effects on cGMP signaling and ischemic injury responses . J Biol Chem 284 : 1116 - 1125 . doi: 10.1074/jbc. M804860200 PMID: 19004835 30. Grimbert P , Bouguermouh S , Baba N , Nakajima T , Allakhverdi Z , Braun D , et al. ( 2006 ) Thrombospondin/CD47 interaction: a pathway to generate regulatory T cells from human CD4+ CD25- T cells in response to inflammation . J Immunol 177 : 3534 - 3541 . PMID: 16951312 31. Johansson U , Higginbottom K , Londei M ( 2004 ) CD47 ligation induces a rapid caspase-independent apoptosis-like cell death in human monocytes and dendritic cells . Scand J Immunol 59 : 40 - 49 . PMID: 14723620 33. Doyen V , Rubio M , Braun D , Nakajima T , Abe J , Saito H , et al. ( 2003 ) Thrombospondin 1 is an autocrine negative regulator of human dendritic cell activation . J Exp Med 198 : 1277 - 1283 . PMID: 14568985 34. Martin-Manso G , Navarathna DH , Galli S , Soto-Pantoja DR , Kuznetsova SA , Tsokos M , et al. ( 2012 ) Endogenous thrombospondin-1 regulates leukocyte recruitment and activation and accelerates death from systemic candidiasis . PLoS One 7: e48775. doi: 10.1371/journal.pone.0048775 PMID: 23144964 35. Soto-Pantoja DR , Stein EV , Rogers NM , Sharifi-Sanjani M , Isenberg JS , Roberts DD ( 2013 ) Therapeutic opportunities for targeting the ubiquitous cell surface receptor CD47 . Expert Opin Ther Targets 17 : 89 - 103 . doi: 10.1517/14728222.2013.733699 PMID: 23101472 36. Chao MP , Weissman IL , Majeti R ( 2012 ) The CD47-SIRPalpha pathway in cancer immune evasion and potential therapeutic implications . Curr Opin Immunol 24 : 225 - 232 . doi: 10.1016/j.coi. 2012 . 01.010 PMID: 22310103 37. Gillum AM , Tsay EY , Kirsch DR ( 1984 ) Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations . Mol Gen Genet 198 : 179 - 182 . PMID: 6394964 38. Navarathna DH , Hornby JM , Hoerrmann N , Parkhurst AM , Duhamel GE , Nickerson KW ( 2005 ) Enhanced pathogenicity of Candida albicans pre-treated with subinhibitory concentrations of fluconazole in a mouse model of disseminated candidiasis . J Antimicrob Chemother 56 : 1156 - 1159 . PMID: 16239285 39. Navarathna DH , Hornby JM , Krishnan N , Parkhurst A , Duhamel GE , Nickerson KW ( 2007 ) Effect of farnesol on a mouse model of systemic candidiasis, determined by use of a DPP3 knockout mutant of Candida albicans . Infect Immun 75 : 1609 - 1618 . PMID: 17283095 40. Raab SS , Cheville JC , Bottles K , Cohen MB ( 1994 ) Utility of Gomori methenamine silver stains in bronchoalveolar lavage specimens . Mod Pathol 7 : 599 - 604 . PMID: 7524071 41. Nickerson WJ ( 1953 ) Reduction of inorganic substances by yeasts . I. Extracellular reduction of sulfite by species of Candida . J Infect Dis 93 : 43 - 56 . PMID: 13069768 42. Lionakis MS , Lim JK , Lee CC , Murphy PM ( 2011 ) Organ-specific innate immune responses in a mouse model of invasive candidiasis . J Innate Immun 3 : 180 - 199 . doi: 10.1159/000321157 PMID: 21063074 43. Young M , Fullerton M , Dilley R , Funder J ( 1994 ) Mineralocorticoids, hypertension, and cardiac fibrosis . J Clin Invest 93 : 2578 - 2583 . PMID: 8200995 44. Shenderov K , Barber DL , Mayer-Barber KD , Gurcha SS , Jankovic D , Feng CG , et al. ( 2013 ) Cord factor and peptidoglycan recapitulate the Th17-promoting adjuvant activity of mycobacteria through mincle/ CARD9 signaling and the inflammasome . J Immunol 190 : 5722 - 5730 . doi: 10.4049/jimmunol.1203343 PMID: 23630357 45. Lionakis MS , Swamydas M , Fischer BG , Plantinga TS , Johnson MD , Jaeger M , et al. ( 2013 ) CX3CR1- dependent renal macrophage survival promotes Candida control and host survival . J Clin Invest 123 : 5035 - 5051 . doi: 10.1172/JCI71307 PMID: 24177428 46. Igyarto BZ , Haley K , Ortner D , Bobr A , Gerami-Nejad M , Edelson BT , et al. ( 2011 ) Skin-resident murine dendritic cell subsets promote distinct and opposing antigen-specific T helper cell responses . Immunity 35 : 260 - 272 . doi: 10.1016/j.immuni. 2011 . 06.005 PMID: 21782478 47. Fortina P , Surrey S ( 2008 ) Digital mRNA profiling . Nat Biotechnol 26 : 293 - 294 . doi: 10.1038/nbt0308- 293 PMID: 18327237 48. Geiss GK , Bumgarner RE , Birditt B , Dahl T , Dowidar N , Dunaway DL , et al. ( 2008 ) Direct multiplexed measurement of gene expression with color-coded probe pairs . Nat Biotechnol 26 : 317 - 325 . doi: 10. 1038/nbt1385 PMID: 18278033 49. D'Angelo JA , Dehlink E , Platzer B , Dwyer P , Circu ML , Garay J , et al. ( 2010 ) The cystine/glutamate antiporter regulates dendritic cell differentiation and antigen presentation . J Immunol 185 : 3217 - 3226 . doi: 10.4049/jimmunol.1001199 PMID: 20733204 50. Dixit E , Boulant S , Zhang Y , Lee AS , Odendall C , Shum B , et al. ( 2010 ) Peroxisomes are signaling platforms for antiviral innate immunity . Cell 141 : 668 - 681 . doi: 10.1016/j.cell. 2010 . 04.018 PMID: 20451243 51. Garay J , D'Angelo JA , Park Y , Summa CM , Aiken ML , Morales E , et al. ( 2010 ) Crosstalk between PKA and Epac regulates the phenotypic maturation and function of human dendritic cells . J Immunol 185 : 3227 - 3238 . doi: 10.4049/jimmunol.0903066 PMID: 20729327 52. Navarathna DH , Nickerson KW , Duhamel GE , Jerrels TR , Petro TM ( 2007 ) Exogenous farnesol interferes with the normal progression of cytokine expression during candidiasis in a mouse model . Infect Immun 75 : 4006 - 4011 . PMID: 17517874 53. Navarathna DH , Lionakis MS , Lizak MJ , Munasinghe J , Nickerson KW , Roberts DD ( 2012 ) Urea amidolyase (DUR1,2) contributes to virulence and kidney pathogenesis of Candida albicans . PLoS One 7: e48475. doi: 10.1371/journal.pone.0048475 PMID: 23144764 54. Navarathna DH , Munasinghe J , Lizak MJ , Nayak D , McGavern DB , Roberts DD ( 2013 ) MRI confirms loss of blood-brain barrier integrity in a mouse model of disseminated candidiasis . NMR Biomed 26 : 1125 - 1134 . doi: 10.1002/nbm.2926 PMID: 23606437 55. Martin P , Leibovich SJ ( 2005 ) Inflammatory cells during wound repair: the good, the bad and the ugly . Trends Cell Biol 15 : 599 - 607 . PMID: 16202600 56. Oldenborg PA , Zheleznyak A , Fang YF , Lagenaur CF , Gresham HD , Lindberg FP ( 2000 ) Role of CD47 as a marker of self on red blood cells . Science 288 : 2051 - 2054 . PMID: 10856220 57. Saito Y , Iwamura H , Kaneko T , Ohnishi H , Murata Y , Okazawa H , et al. ( 2010 ) Regulation by SIRP {alpha} of dendritic cell homeostasis in lymphoid tissues . Blood 116 : 3517 - 3525 . doi: 10.1182/blood2010- 03 -277244 PMID: 20682853 58. Raymond M , Rubio M , Fortin G , Shalaby KH , Hammad H , Lambrecht BN , et al. ( 2009 ) Selective control of SIRP-alpha-positive airway dendritic cell trafficking through CD47 is critical for the development of T (H)2-mediated allergic inflammation . J Allergy Clin Immunol 124 : 1333 - 1342 e1331. doi: 10.1016/j. jaci. 2009 . 07.021 PMID: 19748659 59. Kurihara H , Harita Y , Ichimura K , Hattori S , Sakai T ( 2010 ) SIRP-alpha-CD47 system functions as an intercellular signal in the renal glomerulus . Am J Physiol Renal Physiol 299 : F517 - 527 . doi: 10.1152/ ajprenal.00571. 2009 PMID: 20554646 60. Casadevall A ( 1995 ) Antibody immunity and invasive fungal infections . Infect Immun 63 : 4211 - 4218 . PMID: 7591049 61. Bellocchio S , Bozza S , Montagnoli C , Perruccio K , Gaziano R , Pitzurra L , et al. ( 2005 ) Immunity to Aspergillus fumigatus: the basis for immunotherapy and vaccination . Med Mycol 43 Suppl 1 : S181 - 188 . PMID: 16110810 62. Van VQ , Lesage S , Bouguermouh S , Gautier P , Rubio M , Levesque M , et al. ( 2006 ) Expression of the self-marker CD47 on dendritic cells governs their trafficking to secondary lymphoid organs . EMBO J 25 : 5560 - 5568 . PMID: 17093498 63. Li Z , He L , Wilson K , Roberts D ( 2001 ) Thrombospondin-1 inhibits TCR-mediated T lymphocyte early activation . J Immunol 166 : 2427 - 2436 . PMID: 11160302 64. Kaur S , Chang T , Singh SP , Lim L , Mannan P , Garfield SH , et al. ( 2014 ) CD47 signaling regulates the immunosuppressive activity of VEGF in T cells . J Immunol in press. doi: 10.4049/jimmunol.1303116 PMID: 25200950 65. Brieland J , Essig D , Jackson C , Frank D , Loebenberg D , Menzel F , et al. ( 2001 ) Comparison of pathogenesis and host immune responses to Candida glabrata and Candida albicans in systemically infected immunocompetent mice . Infect Immun 69 : 5046 - 5055 . PMID: 11447185 66. Fortin G , Raymond M , Van VQ , Rubio M , Gautier P , Sarfati M , et al. ( 2009 ) A role for CD47 in the development of experimental colitis mediated by SIRPalpha+CD103- dendritic cells . J Exp Med 206 : 1995 - 2011 . doi: 10.1084/jem.20082805 PMID: 19703989 67. Baba N , Van VQ , Wakahara K , Rubio M , Fortin G , Panzini B , et al. ( 2013 ) CD47 fusion protein targets CD172a+ cells in Crohn's disease and dampens the production of IL-1beta and TNF . J Exp Med 210 : 1251 - 1263 . doi: 10.1084/jem.20122037 PMID: 23669395 68. Scott CL , Tfp ZM , Beckham KS , Douce G , Mowat AM ( 2014 ) Signal regulatory protein alpha (SIRPalpha) regulates the homeostasis of CD103(+) CD11b(+) DCs in the intestinal lamina propria . Eur J Immunol 44 : 3658 - 3668 . doi: 10.1002/eji.201444859 PMID: 25236797 69. Lamy L , Foussat A , Brown EJ , Bornstein P , Ticchioni M , Bernard A ( 2007 ) Interactions between CD47 and thrombospondin reduce inflammation . J Immunol 178 : 5930 - 5939 . PMID: 17442977 70. Luster AD ( 1998 ) Chemokines-chemotactic cytokines that mediate inflammation . N Engl J Med 338 : 436 - 445 . PMID: 9459648 71. Overland G , Stuestol JF , Dahle MK , Myhre AE , Netea MG , Verweij P , et al. ( 2005 ) Cytokine responses to fungal pathogens in Kupffer Cells are Toll-like receptor 4 independent and mediated by tyrosine kinases . Scand J Immunol 62 : 148 - 154 . PMID: 16101821 72. Dunne A , O'Neill LA ( 2003 ) The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense . Sci STKE 2003 : re3. PMID: 12606705 73. McAllister F , Henry A , Kreindler JL , Dubin PJ , Ulrich L , Steele C , et al. ( 2005 ) Role of IL-17A, IL-17F, and the IL-17 receptor in regulating growth-related oncogene-alpha and granulocyte colony-stimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis . J Immunol 175 : 404 - 412 . PMID: 15972674

This is a preview of a remote PDF:

Dhammika H. M. L. P. Navarathna, Erica V. Stein, Elizabeth C. Lessey-Morillon, Debasis Nayak, Gema Martin-Manso, David D. Roberts. CD47 Promotes Protective Innate and Adaptive Immunity in a Mouse Model of Disseminated Candidiasis, PLOS ONE, 2015, DOI: 10.1371/journal.pone.0128220