PacCYP707A2 negatively regulates cherry fruit ripening while PacCYP707A1 mediates drought tolerance

Journal of Experimental Botany, Jun 2015

Sweet cherry is a non-climacteric fruit and its ripening is regulated by abscisic acid (ABA) during fruit development. In this study, four cDNAs (PacCYP707A1–4) encoding 8′-hydroxylase, a key enzyme in the oxidative catabolism of ABA, were identified in sweet cherry fruits using tobacco rattle virus-induced gene silencing (VIGS) and particle bombardment approaches. Quantitative real-time PCR confirmed significant down-regulation of target gene transcripts in VIGS-treated cherry fruits. In PacCYP707A2-RNAi-treated fruits, ripening and fruit colouring were promoted relative to control fruits, and both ABA accumulation and PacNCED1 transcript levels were up-regulated by 140%. Silencing of PacCYP707A2 by VIGS significantly altered the transcripts of both ABA-responsive and ripening-related genes, including the ABA metabolism-associated genes NCED and CYP707A, the anthocyanin synthesis genes PacCHS, PacCHI, PacF3H, PacDFR, PacANS, and PacUFGT, the ethylene biosynthesis gene PacACO1, and the transcription factor PacMYBA. The promoter of PacMYBA responded more strongly to PacCYP707A2-RNAi-treated fruits than to PacCYP707A1-RNAi-treated fruits. By contrast, silencing of PacCYP707A1 stimulated a slight increase in fruit colouring and enhanced resistance to dehydration stress compared with control fruits. These results suggest that PacCYP707A2 is a key regulator of ABA catabolism that functions as a negative regulator of fruit ripening, while PacCYP707A1 regulates ABA content in response to dehydration during fruit development.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

PacCYP707A2 negatively regulates cherry fruit ripening while PacCYP707A1 mediates drought tolerance

Journal of Experimental Botany PacCYP707A2 negatively regulates cherry fruit ripening while PacCYP707A1 mediates drought tolerance Qian Li 1 Pei Chen 1 Shengjie Dai 1 Yufei Sun 1 Bing Yuan 0 Wenbin Kai 1 Yuelin Pei 1 Suihuan He 1 Bin Liang 1 Yushu Zhang Ping Leng 1 These authors contributed equally to the present work. To whom correspondence should be addressed at No. 0 West Yuanmingyuan Road Beijing China. E-mail: 0 Department of Chemistry and Biochemistry, University of Arizona , 1306 East University BouleVard, Tucson, AZ , USA 1 College of Agronomy and Biotechnology, China Agricultural University , Beijing 100193 , PR China Sweet cherry is a non-climacteric fruit and its ripening is regulated by abscisic acid (ABA) during fruit development. In this study, four cDNAs (PacCYP707A1-4) encoding 8′-hydroxylase, a key enzyme in the oxidative catabolism of ABA, were identified in sweet cherry fruits using tobacco rattle virus-induced gene silencing (VIGS) and particle bombardment approaches. Quantitative real-time PCR confirmed significant down-regulation of target gene transcripts in VIGS-treated cherry fruits. In PacCYP707A2-RNAi-treated fruits, ripening and fruit colouring were promoted relative to control fruits, and both ABA accumulation and PacNCED1 transcript levels were up-regulated by 140%. Silencing of PacCYP707A2 by VIGS significantly altered the transcripts of both ABA-responsive and ripening-related genes, including the ABA metabolism-associated genes NCED and CYP707A, the anthocyanin synthesis genes PacCHS, PacCHI, PacF3H, PacDFR, PacANS, and PacUFGT, the ethylene biosynthesis gene PacACO1, and the transcription factor PacMYBA. The promoter of PacMYBA responded more strongly to PacCYP707A2-RNAi-treated fruits than to PacCYP707A1-RNAi-treated fruits. By contrast, silencing of PacCYP707A1 stimulated a slight increase in fruit colouring and enhanced resistance to dehydration stress compared with control fruits. These results suggest that PacCYP707A2 is a key regulator of ABA catabolism that functions as a negative regulator of fruit ripening, while PacCYP707A1 regulates ABA content in response to dehydration during fruit development. ABA; CYP707A; cherry ripening; colouring; dehydration stress; particle bombardment; VIGS - © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. is well understood, and ABA is known to be synthesized de novo from a C40 carotenoid. An important phase of ABA biosynthesis is initiated in plastids with the hydroxylation and epoxidation of β-carotene to produce the all-trans-xanthophylls zeaxanthin and violaxanthin. Violaxanthin is then converted to 9-cis-epoxyxanthophylls, which are oxidatively cleaved by 9-cis-epoxycarotenoid dioxygenases (NCEDs) to yield xanthoxin, the first C15 intermediate of ABA biosynthesis. Xanthoxin exits the plastid and is oxidized in the cytosol in two further steps to generate ABA (Qin and Zeevaart, 1999; Schwartz et  al., 2003; Taylor et  al., 2005). ABA catabolism proceeds predominantly via hydroxylation of the C-8′ methyl group, which is mediated in Arabidopsis by a cytochrome P450 (CYP) monooxygenase encoded by a member of the CYP707A gene family (Krochko et al.,1998; Saito et  al., 2004; Kushiro et  al., 2004). CYP707A, the key ABA catabolic enzyme, was first characterized in Arabidopsis (Kushiro et al., 2004; Saito et al., 2004), and has since been cloned and characterized from various climacteric fruit species including tomato (Sun et  al., 2012a, b) and persimmon (Zhao et al., 2012), as well as non-climacteric fruits such as pear (Dai et al., 2014) and grape (Sun et al., 2010). CYP707A genes are involved in several physiological processes including seed dormancy and germination, dehydration and rehydration, and stomatal movement (Millar et al., 2006; Okamoto et al., 2006). In recent years, considerable progress has been made in our understanding of ABA signal transduction (Ma et al., 2009; Melcher et al., 2009; Nishimura et al., 2009; Park et al., 2009), and epigenetic mechanisms for ABA signalling have been reported (Zhang et  al., 2011, 2012; Ding et  al., 2014). Furthermore, it is reported that ABA might directly regulate the expression of PacMYBA, a transcription factor that interacts with several anthocyanin-related bHLH transcription factors to further activate the promoters of key anthocyanin biosynthesis genes (Shen et al. 2014). However, whether and how CYP707A genes are involved in the regulation of ABA in cherry fruit ripening remains unclear. In this study, four CYP707A enzymes were identified in sweet cherry. PacCYP7072 was found to be the key gene regulating ABA levels during fruit ripening, while PacCYP7071 regulates the response to dehydration stress during fruit development. Materials and methods Plant materials and treatments Sweet cherry (Prunus avium L. cv. Satonishiki) fruits were collected from 10-year-old cherry trees grown in an experimental orchard at the China Agricultural University (Beijing, PR China) in the spring of 2013. Fruits were sampled at 21, 25, 29, 32, 36, 40, and 43 d after full bloom (DAFB). All fruits were collected from the middle of the branch and fresh fruits were used for the determination of pulp firmness, total soluble sugar (TSS), anthocyanin accumulation, and ABA content. Fresh fruits were frozen in liquid nitrogen immediately after separation and stored at –80 °C for RNA extraction. Fruit dehydration In order to evaluate the effect of dehydration stress, 120 fruits were harvested at the de-greening stage 32 DAFB and divided evenly into two groups. The first group (control) was stored at 24 °C under high relative humidity (RH; 100%). The second group (dehydration stress) was stored at the same temperature and subjected to identical treatments but under low RH (45%; dehydrated fruits). Three days after treatment, the second group was transferred from 45% RH to 100% RH for a 1 d recovery period. ABA content and gene expression in the pulp were determined 0, 3, and 4 d after treatment. Each individual fruit was weighed immediately after harvest and weighed again before sampling to calculate the rate of water loss (the ratio of the decreased fruit weight to the initial fruit weight). In order to evaluate the effect of dehydration stress on PacCYP707A1/2-RNAi-treated fruits, cherry fruits were harvested and divided into two groups 7 d after being treated with the PacCYP707A1/2-RNAi TRV vector. Each group contained 30 control fruits, 30 PacCYP707A1-RNAi-treated fruits, and 30 PacCYP707A2-RNAi-treated fruits. Group I  fruits were stored in 100% RH as a control. Group II fruits were stored in 45% RH, and fruits were sampled 0, 1, 2, and 3 d after treatment. Fruits were immediately frozen in liquid nitrogen, powdered, mixed, and stored at –80 °C for further use. The rate of water loss was calculated as described above. Construction of the viral vector and agroinoculation The pTRV1 and pTRV2 virus-induced gene-silencing vectors (Liu et al., 2002) were kindly provided by YL Liu (School of Life Science, Tsinghua University, Beijing, China). A  specific cDNA fragment of CYP707A1 or CYP707A2 gene was amplified using appropriate primers (Table 1), and the amplified fragments were cloned into EcoRI/SacI-digested pTRV2. Agrobacterium tumefaciens strain GV3101 containing pTRV1, pTRV2, and pTRV2-CYP707A1/2 were used for RNAi. Sixty fruits from three independent cherry trees grown in the experimental orchard were selected for inoculation and the CYP707A1/2-RNAi TRV vector was injected into each basal pedicel 28 DAFB (de-greening stage). Fruits were evaluated 7 d after treatment. Determination of fruit-soluble solids content Ten randomly selected fruits per treatment were juiced to determine the soluble solids content (SSC) every four days from 21 DAFB. Data were obtained by squeezing the mesocarp with a Pal-1 pocket refractometer (ATAGO, Tokyo, Japan; units, oBrix). Determination of fruit firmness Cherry fruits were harvested at different ripening stages and the pulp firmness of 15 fruits was determined after removal of the skin on each side of the fruit suture using a KM-model fruit hardness tester (Fujihara Co., Japan). The units of pulp firmness used in this study were kg cm–1. Anthocyanin extraction and determination The anthocyanin concentration was determined by extracting peel with 1% HCl methanol and measuring the absorbance at Table 1. The specific primers used for VIGS in this study PacCYP707A1 F-v, GU559987 (GenBank) PacCYP707A1 R-v, GU559987 (GenBank) PacCYP707A2 F-v, GU559988 (GenBank) PacCYP707A2 R-v , GU559988 (GenBank) CGGGAATCTCTTCAGTCCTGGGAAGGCCGCTTGAT CGGGAGCACCCTCCTCTTCTTCTTTTGTCCTC CGGGAATCGTGGACAACATCATCGGGGTAAT CGGGAGCGGAACAAAGGCAGTACCTTCCATCCCT Table 2. Primers used in qRT-PCR experiments CTCCAGAGTTCCGTATGGTTTTC GGAAGCAGGTGGAGGACCATAAG GAACAATCACCACCACAAAGAACTG GAGAAGCAGTGGAAGACGTGGAGT CACATACCCCAAAAGCAAAGAACGT AGGGTGCTCGTGTTCTTGTTGTGTGC CCGTCAGTCAAACCACCAGGCTCAG TGTGGAGGCTTGTGAGGATTGGGG GCCTTTTTCGATCTTCCCAT CAAGCCAACAATAAATGGGGTGCTAG GGTGTTTGATGTGCTGATGG GACAAATGGATTGATGTTCCACCG GGTGGTCATTGATTGCTGGA CTCCTCTCAACCCTAAGGCTAACAG TAGCTTCCCACAGGTAATTGTCC GTTGTGTCACGAGCAGCGAAAAT CTTGCCGAGACCGATTTATTGTATG CAAATTTTTCGGGATGAGGGAAGA CCCAGGAGTCTGAGCCAGACACA CTGTCGGGAAGGATGGTTTG TCCAGCCCCCTCACCCCT GTAAATGGCTGGAGACGATG CTTCTCCAGCCTCCCTTCTT GCAGAGGATGTAAACACCAG GCTGGTTGTAAAGTTGTGGGG ACAGCATCACTCCCCGGATTGTA GTGATGTTTGTGATGGCGTA CAGTTGTACGACCACTGGCATACAG wavelengths of 530 nm and 657 nm. The formula A=A530–0.25A657 was used to compensate for the contribution of chlorophyll and its degradation products to the absorption at 530 nm (Rabino and Mancinelli, 1986). Anthocyanin concentrations are relative, and A=0.01 was equal to one unit (U). All measurements were repeated five times with an equal quantity of peel. Quantitative real-time PCR analysis Total RNA was isolated from cherry fruit samples using the hot borate method (Wan and Wilkins, 1994). Genomic DNA was eliminated using an RNase-free DNase I kit (Takara, China) according to the manufacturer’s recommendations. For each RNA sample, quality and quantity were assessed by agarose gel electrophoresis. cDNA was synthesized from total RNA using the PrimeScript RT reagent kit (Takara) according to the manufacturer’s recommendations. Primers used for real-time PCR are listed in Table 2 and were designed using Primer 5 software ( Actin was used as an internal control, and the stability of its expression was tested in preliminary studies as previously described (Ren et al., 2011). All primer pairs were tested by PCR. The presence of a single product of the correct size for each gene was confirmed by agarose gel electrophoresis and double-strand sequencing (Invitrogen). Amplified fragments were subcloned into the pMD18-T vector (Takara), and used to generate standard curves through serial dilution. Real-time PCR was performed using a Rotor-Gene 3000 system (Corbett Research, China) with SYBR Premix Ex Taq (Takara). Each 20 μl reaction contained 0.8 μl of primer mixer (containing 4 μM of each forward and reverse primer), 1.5 μl cDNA template, 10 μl SYBR Premix Ex Taq (2x) mixer, and 7.7 μl water. Reactions were performed under the following conditions: 95 °C for 30 s (one cycle), 95 °C for 15 s, 60 °C for 20 s, and 72 °C for 15 s (40 cycles). Relative fold changes in expression were calculated using the relative two standard curves method in the Rotor-Gene 6.1.81 software (Invitrogen). Construction and transformation of the PacMybA1 promoter::GUS vector The PacMYBA1 promoter sequence was inserted into PstI/BamHIdigested pBI121 vector and fused upstream to the GUS gene to replace the CaMV 35S promoter. The resultant construct was transformed into cherry fruits (controls) at 32 DAFB using particle bombardment as described by Sun et al. (2011). CYP707A1/2-RNAitreated fruits were harvested 7 d after inoculation and subjected to the same procedures as control fruits (Sun et al., 2011). The pedicel detaching zone was used for particle bombardment, after which the target area was immediately covered with parafilm and incubated in a tissue-culture room for 24 h at 25 °C. GUS assays were carried out according to the method of Jefferson (1987). Particle bombardment of cherry fruits Tungsten particles were coated with plasmid as follows: 50 μl of prepared tungsten particle suspension in a 0.15 ml centrifuge tube was supplemented with 5 μg of plasmid, 50 μl of 2.5 M CaCl2 and 20 μl of 0.1 M spermine in that order, mixed by vortexing for 3 min, and incubated on ice for 5 min. Following centrifugation at 8 000 rpm for 1 min, the supernatant was removed and the particles were resuspended in 150  μl of 70% ethanol and vortexed for another 3 min. Following centrifugation as before, particles were resuspended in 150  μl of 100% ethanol, incubated on ice for 5 min, centrifuged, and finally resuspended in 60 μl of 100% ethanol. Plasmid-coated tungsten particles were vortexed for 30 s and 10  μl was deposited onto a macroprojectile which was placed in a Petri dish filled with anhydrous CaCl2. Each macroprojectile was coated with 0.83 μg of plasmid. A Scientz GJ-1000 nitrogen-driven particle delivery system (Ningbo Scientz Biotechnology Co., Ltd, China) was used, and a partial vacuum of 71 mm Hg was used for all bombardments. Histochemical staining of GUS activity The GUS assay buffer contained three components: A=basic phosphate buffer (50 mM sodium phosphate pH 7, 1 mM K3Fe(CN)6, 1 mM K4Fe(CN)6, 10 mM Na2EDTA, 0.1% (v/v) Triton X-100); B=anhydrous methanol; C=20 mM X-Gluc:5- bromo-4-chloro-3indolyl-β-d glucuronide cyclohexylammonium salt in dimethyl formamide solvent. Components A, B, and C were used in a 40:10:1 ratio. Following incubation in the tissue culture room for 24 h at 25 °C, the parafilm was removed from the target area and the pulp surface layer was cut into thin (2–3 mm) slices, placed in a 5 ml centrifuge tube containing 3 ml assay buffer and incubated for 24 h at 37 °C. To improve visual clarity, green or red pulp was discoloured with 70% ethanol. Expression of PacCYP707A genes during cherry fruit development and ripening Sweet cherry fruits were sampled at seven visually distinct ripening stages based on fruit colouring and days after full bloom (DAFB) as follows: mid green (MG), 21 DAFB; big green (BG), 25 DAFB; de-greening (DG), 28 DAFB; yellow (YW), 32 DAFB; initial red (IR), 36 DAFB; full red (FR), 40 DAFB; dark red (DR), 44 DAFB. ABA levels and expression of PacNCED1, a key enzyme in ABA biosynthesis, began to increase in pulp at 25 DAFB, coinciding with termination of pit hardening and a sharp decline in fruit firmness (Fig. 1). Both parameters peaked at 36 DAFB before declining (Fig. 1B). In pulp, PacCYP707A1 transcript levels were relatively low at 21 DAFB but increased dramatically to a maximum at 25 DAFB (Fig. 1A), at which point the ABA content reached its lowest level. After 25 DAFB, PacCYP707A1 expression dramatically decreased up to 32 DAFB, when the ABA content began to increase. After 32 DAFB, PacCYP707A1 transcript abundance began to increase slowly up to 44 DAFB (Fig. 1A). The expression pattern of PacCYP707A2 was similar to PacCYP707A1, increasing steadily up to 32 DAFB before declining to its lowest level at 36 DAFB. PacCYP707A2 transcript levels were higher than the other three PacCYP707As genes. Expression of PacCYP707A3 and PacCYP707A4 remained relatively low throughout fruit development and ripening compared with PacCYP707A1 and PacCYP707A2 (Fig.  1A). These results indicated that PacCYP707A2 is mainly involved in regulating ABA during the onset of ripening, whereas PacCYP707A1 is more important for regulating ABA content during the later stages of fruit ripening. Expression of PacCYP707A genes in response to dehydration To investigate the regulatory roles of PacCYP707A genes, gene expression patterns in developing fruits in response to dehydration stress were analysed. Fruits harvested at 32 DAFB were divided into two groups and stored under either low RH (45%) or high RH (100%) conditions for 3 d. Fruits lost 16% of their water content in 45% RH, and ABA content and PacNCED1 transcript levels were significantly elevated in dehydrated fruits compared with the controls (Fig.  2). By contrast, expression of PacCYP707A1 was significantly down-regulated following dehydration, and PacCYP707A3 expression was also down-regulated, albeit to a lesser extent, and expression of PacCYP707A4 and PacCYP707A2 was unaffected by dehydration (Fig.  2). PacCYP707A1 underwent the most dramatic change in expression, suggesting this may be the primary drought-responsive member of the PacCYP707A gene family during fruit ripening. PacCYP707A2 silencing promotes fruit colouring and ripening To clarify the role of PacCYP707A2 in the regulation of ABA during fruit ripening further, ABA concentration and the expression of ABA-associated genes were measured in both RNAi-treated (Fig.  3) and control fruits. Injection of PacCYP707A2-RNAi TRV vector into growing fruits at 28 DAFB (de-greening stage) resulted in a faster accumulation of red colour (Fig.  7A) and more rapid ripening than controls 6 d after RNAi-treatment (Fig.  7F, control fruit on the right). At 12 d after RNAi-treatment (DAT), the time of fruit harvesting, pulp colour was more intensely red (Fig. 7E) than both non-silenced control fruits (Fig. 7C) and PacCYP707A1-RNAi-treated fruits (Fig. 7D). Indeed, treatment with PacCYP707A1-RNAi had no effect on pulp colour at 6 DAT (Fig. 7G, control fruit on the right), although pulp colour was slightly redder (Fig. 7D) than controls at the harvesting stage (Fig.  7C), but was much less intense than PacCYP707A2-RNAi-treated fruits. In PacCYP707A1/2RNAi-treated fruits, the ABA content was higher than controls at 12 DAT (harvest stage) (Fig. 5). PacCYP707A2 silencing affected the expression of ABA-responsive genes PacCYP707A2 expression was down-regulated to 15% of controls in PacCYP707A2-RNAi-treated fruits during the de-greening stage, while PacCYP707A1 expression was down-regulated to 60% and PacCYP707A3/4 expression was slightly up-regulated during the de-greening and initial red stages (Fig.  4). Expression of PacNCED1 was up-regulated in PacCYP707A1/2-RNAi-treated fruits (Fig. 4). Three ABA receptor genes (PYLs), six 2C protein phosphatases (PP2Cs), and six subfamily 2 SNF1-related kinases (SnRK2s) were previously cloned from cherry fruits (Wang et al., 2015). Of these, PacPYL2, PacPP2C3, and PacSnRK2.3 were strongly expressed in sweet cherry fruits during ripening, but expression of the other genes was very low. In PacCYP707A1/2-RNAitreated fruits PacPYL2 and PacSnRK2.3 were up-regulated, while PacPP2C3 was down-regulated (Fig. 4). Fruit firmness was lower than controls in PacCYP707A2-RNAi-treated fruits, but was comparable with controls in PacCYP707A1silenced fruits. The soluble solid, anthocyanin and ABA content were all clearly elevated in PacCYP707A2-RNAitreated fruits compared with controls, but only slightly upregulated in PacCYP707A1-RNAi-treated fruits (Fig. 5). The expression of anthocyanin synthesis pathway genes PacCHS, PacCHI, PacF3H, PacDFR, PacANS, and PacUFGT was up-regulated by PacCYP707A2 silencing during initial red and full red stages (Fig.  6B–G). PacMybA expression was Fig. 2. Effect of dehydration stress on ABA accumulation and expression of PacNCED1 and four PacCYP707As. Cherry fruits were harvested at 32 d after full bloom and divided into three groups. Group 1 fruits (controls) were stored under 100% relative humidity (RH), group 2 (dehydration) were stored under 45% RH, and group 3 (recovery) were stored under 45% RH for 3 d then 100% RH for 1 d. All fruits were stored at or below 25 °C and sampled at 0, 3, and 4 d after treatment. Three biological replicates (n=3) were used for each analysis. (*,**) Values that are significantly different at the level of 0.05 and 0.01, respectively. Fig. 3. Construction of pTRV1, pTRV2, and pTRV2-derivative gene-silencing vectors as described by Liu et al. (2002). TRV cDNA clones were placed between duplicated CaMV 35S promoters and the nopaline synthase terminator in a T–DNA vector. pTRV2-target gene (sense orientation) was constructed to assess the ability of TRV vectors to suppress expression of the target gene in cherry fruits. RdRp, RNA-dependent RNA polymerase; 16K, 16 kDa cysteine-rich protein; MP, movement protein; CP, coat protein; LB and RB, left and right borders of T–DNA, respectively; R, self-cleaving ribozyme; MCS, multiple cloning sites. particularly elevated in PacCYP707A2-RNAi-treated fruits (Fig.  6A). In addition, ABA accumulation and PacNCED1 transcript levels were up-regulated in PacCYP707A2-RNAitreated fruits, and this significant increase in NCED activity led to the up-regulation of PacACO1 that encodes ACC oxidase (Fig. 6H). PacMybA1 promoter responded to both PacCYP707A1-RNAi-treated and PacCYP707A2-RNAi-treated fruits To investigate the effects of PacCYP707A1/2-RNAi in fruit colouring and ripening further, the responses of PacMybA promoter to PacCYP707A1/2-RNAi were detected. The promoter sequence was taken from the cherry fruits. It is found that the PacMybA promoter sequence contained two ABRE (ABA-responsive element) motifs with the core sequences TACGTG and CCTACGTGGC, respectively, but no ERE element (Shen et al., 2014). To verify that PacMybA1 exhibited a different response to PacCYP707A1-RNAi-treated and PacCYP707A2-RNAi-treated fruits, transient expressions of histochemical GUS staining and GUS activity were analysed in cherry fruits using a particle gun which expressed the constructions of PacMybA1 promoter::GUS (Fig.  7H–L). For the transient expression of PacMybA1 promoter::GUS, PacCYP707A1-RNAi (Fig. 7H, I) and PacCYP707A2-RNAi (Fig.  7J, K) treatments generated clear strong staining and high elevated GUS activity (Fig.  7L) compared with the control. The effect of PacCYP707A2-RNAi treatment was stronger than the PacCYP707A1-RNAi treatment (Fig. 7L). PacCYP707A1 silencing improves tolerance to dehydration In PacCYP707A1-RNAi-treated fruits, expression of PacCYP707A1 was down-regulated to 20%, while expression of PacCYP707A3/4 was slightly up-regulated, and no obvious changes in PacCYP707A2 expression were apparent at Fig. 5. Changes in fruit firmness, solid soluble, anthocyanin, and ABA content in control, PacCYP707A1-RNAi-treated and PacCYP707A2-RNAi-treated fruits. A total of 10 fruits from each group were harvested at the full red stage. Three biological replicates (n=3) were used for each analysis. (*,**) Values that are significantly different at the level of 0.05 and 0.01, respectively. 7 DAT. Since PacCYP707A1-RNAi-treated fruits exhibited enhanced drought tolerance, the ABA content rate of water loss was examined during the initial red stage. Both control and PacCYP707A1/2-RNAi-treated fruits were harvested at 7 DAT and fruits were then incubated at 20 °C and 45% RH. The rate of water loss was lowest in PacCYP707A1-RNAi fruits, but was only slightly lower in PacCYP707A2-RNAi fruits than the controls at 2–4 d after dehydration (Fig.  8A). However, there were no large differences in the rate of water loss between the controls and PacCYP707A2-RNAi-treated fruits (Fig. 8A). PacCYP707A1-RNAi treatment therefore significantly improved resistance to dehydration stress compared with the controls. After 4 d of dehydration stress, control fruits were severely wilted, but this phenotype only appeared after Fig. 8. Rate of water loss and ABA content of PacCYP707A1/2-RNAi-treated fruits. Fruits were injected with PacCYP707A1/2-RNAi TRV vectors at 28 d after full bloom (DAFB). Fruits harvested at 40 DAFB were divided into two groups stored at 25 °C and 100% relative humidity (Group 1, control) or 25 °C and 45% relative humidity (Group 2, dehydration). Fruits were sampled at 0, 2, and 4 d after dehydration treatment. Actin was used as an internal control. Three biological replicates (n=3) were used for each analysis. a much longer dehydration period in PacCYP707A1-RNAi fruits. Indeed, almost all PacCYP707A1-RNAi fruits recovered within 4 d of rehydration, while only 70–80% of control or PacCYP707A2-RNAi-treated fruits survived this experimental regime. ABA levels were found to be higher in PacCYP707A1RNAi-treated fruits than those in control and PacCYP707A2RNAi-treated fruits (Fig.  8B). The ABA content in both control and PacCYP707A1/2-RNAi-treated fruits increased at 2–4 d after dehydration treatment, but ABA levels were highest in PacCYP707A1-RNAi-treated fruits (Fig. 8B). This may be due to the reduced expression of PacCYP707A1 in these fruits. Together, these results suggest that PacCYP707A1 plays a crucial role in tolerance to dehydration in cherry fruits. In the fruits of the sweet cherry tree, endogenous ABA levels are determined by the dynamic balance of biosynthesis and catabolism (Fig.  1). Previous studies suggest NCEDs and CYP707As, respectively, mediate ABA biosynthesis and catabolism and their spatio-temporal expression is regulated at the transcriptional level (Saito et  al., 2004; Setha et  al., 2005). In many cases, expression of NCEDs and CYP707As is co-regulated by exogenous environmental stresses during plant development (Nitsch et al., 2009). For example, ABA levels in tomato are primarily regulated by LeNCED1 and SlCYP707A2 (Sun et  al., 2012a; Ji et al., 2014). Despite the fact that ABA catabolism plays an important role in regulating ABA levels in many physiological processes, evidence concerning the role of ABA catabolic genes in fruit development/ripening and tolerance to drought stress is scarce. Expression of CYP707As during fruit development/ripening and drought tolerance has been shown to exhibit an opposite trend to ABA content in a variety of fruits (Qin et al., 1999; Ren et al., 2011, Sun et  al., 2012a; Wang et  al., 2013). This trend was mirrored in sweet cherry fruits in the present study; expression of PacCYP707A1/2 increased dramatically from 20–25 DAF but was low from 32–44 DAF, which was opposite to the ABA content (Fig.  1). These results indicate possible coregulation of ABA content and PacCYP707A1/2 expression at the transcriptional level. PacCYP707A2 may, therefore, play a primary role in regulating ABA levels during the initiation of cherry fruit ripening, and this was investigated using VIGS-induced PacCYP707A2-RNAi (Fig.  3). PacCYP707A2 silencing resulted in increased ABA content at the fruit breaking and turning stages and the elevated ABA, in turn, stimulated the expression of the transcription factor PacMybA that regulates anthocyanin biosynthesis and accelerates fruit colouring and ripening (Figs 6, 7). PacCYP707A2-RNAi treatment significantly enriched anthocyanin accumulation in pulp at the fully ripe stage (Fig.  7E) compared with hte controls (Fig. 7B). This phenotype resembled that following suppression of SlCYP707A2 genes in tomato, which also increased ABA levels and expedited fruit ripening (Ji et  al., 2014). Thus, PacCYP707A2 may be a key gene in the regulation of ABA catabolism during the onset of ripening during cherry fruit de-greening. In addition, when PacCYP707A1/2-RNAi fruits were bombarded with tungsten projectiles coated with PacMYBA promoter::GUS plasmid DNA, both GUS staining (Fig. 7K) and GUS activity (Fig. 7L) were elevated compared with PacCYP707A1-RNAi fruits (Fig.  7I). This may be because ABA accumulation was higher in PacCYP707A2RNAi fruits than in PacCYP707A1-RNAi fruits, and the PacMYBA promoter sequence contains two ABA response elements (ABREs) (Shen et al., 2014). These results suggest that suppression of PacCYP707A2 expression and overexpression of PacNCED1 have a similar effect on the regulation of fruit ripening. Water deficit in fruit is a direct result of osmotic stress caused by drought or excess salinity. It is well known that ABA content and ABA biosynthetic genes are up-regulated by abiotic stresses. In Arabidopsis, ABA is also involved in the reutilization and transport of Fe from roots to shoots under conditions of Fe deficiency (Lei et  al., 2014). In the present study, four PacCYP707A genes were differentially expressed in sweet cherry fruits in responsive to dehydration stress. PacCYP707A1 expression decreased dramatically following dehydration but recovered after rehydration, and this trend was the opposite to the changes in ABA level (Fig.  2). PacCYP707A1 may, therefore, be the major ABA catabolic gene responsible for negatively regulating ABA levels during dehydration in cherry fruits, which is consistent with previous reports (Saito et al., 2004; Umezawa et al., 2006). To investigate these findings further, VIGS experiments were performed, and PacCYP707A1-RNAi-treated fruits exhibited enhanced drought resistance and increased ABA accumulation relative to the controls (Fig. 8). This indicates that down-regulation of PacCYP707A1 was responsible for the dehydration-induced ABA accumulation that led to improved drought tolerance. By contrast, silencing of PacCYP707A2 did not prevent water loss, suggesting this is not a drought-associated gene in cherry fruits. In addition, changes in PacNCED1 expression were less pronounced than those of PacCYP707A1 under dehydration conditions, suggesting there may be NCED genes other than PacNCED1 that respond to dehydration stress in this species. In conclusion, of the four PacCYP707A genes identified in sweet cherry fruits, PacCYP707A2 plays a crucial role in regulating ABA levels during fruit development and maturation, while PacCYP707A1 is more involved in drought tolerance. Acknowledgements We would like to thank Dr Yu-Le Liu (Qinghua University, China) for the pTRV vectors. We would like to thank the native English speaking scientists of Elixigen Company for editing our manuscript. Basanta MF , Ponce NM , Salum ML , Raffo MD , Vicente AR , ErraBalsells R , Stortz CA . 2014 . Compositional changes in cell wall polysaccharides from five sweet cherry (Prunus avium L.) cultivars during on-tree ripening . Journal of Agricultural and Food Chemistry doi:10 .1021/ jf504357u. Dai S , Li P , Chen P , et al. 2014 . Transcriptional regulation of genes encoding ABA metabolism enzymes during the fruit development and dehydration stress of pear Gold Nijisseiki' . Plant Physiology and Biochemistry 82 , 299 - 308 . Ding ZJ , Yan JY , Xu XY , Yu DQ , Li GX , Zhang SQ , Zheng SJ . 2014 . Transcription factor WRKY46 regulates osmotic stress responses and stomatal movement independently in Arabidopsis . The Plant Journal 79 , 13 - 27 . Gong YP , Fan XT , Mattheis JP . 2002 . Response of 'Bing' and 'Rainier' sweet cherries to ethylene and 1-methylcyclopropene . Journal of the American Society for Horticultural Science 127 , 831 - 835 . Ishiguro T , Yamaguchi M , Nishimura K , Satoh I. 1993 . Changes of fruit characteristics and respiration in sweet cherry (Prunus avium L.) during ripening . Journal of the Japanese Society for Horticulture Science 62 , Supplement 2, 146 - 147 . Jefferson RA . 1987 . Assaying chimeric genes in plants, the GUS gene fusion system . Plant Molecular Biology Reporter 5 , 387 - 405 . Ji K , Kai W , Zhao B , et al. 2014 . SlNCED1 and SlCYP707A2: key genes involved in ABA metabolism during tomato fruit ripening . Journal of Experimental Botany 65 , 5243 - 5255 . Kondo S , Gemma H. 1993 . Relationship between abscisic acid (ABA) content and maturation of the sweet cherry . Journal of the Japanese Society for Horticulture Science 62 , 63 - 68 . Kondo S , Inoue K. 1997 . Abscisic acid (ABA) and 1-aminocyclopropane1-carboxylic acid (ACC) content during growth of 'Satonishiki' cherry fruit, and the effect of ABA and ethephon application on fruit quality . Journal of Horticultural Science 72 , 221 - 227 . Krochko JE , Abrams GD , Loewen MK , Abrams SR , Cutler AJ . 1998 . (+)-Abscisic acid 8′-hydroxylase is a cytochrome P450 monooxygenase . Plant Physiology 118 , 849 - 860 . Kushiro T , Okamoto M , Nakabayashi K , Yamagishi K , Kitamura S , Asami T , Hirai N , Koshiba T , Kamiya Y , Nambara E. 2004 . The Arabidopsis cytochrome P450 CYP707A encodes ABA 8ʹ-hydroxylases, key enzymes in ABA catabolism . EMBO Journal 23 , 1647 - 1656 . 2014. Abscisic acid alleviates iron deficiency by promoting root iron reutilization and transport from root to shoot in Arabidopsis . Plant, Cell and Environment 37 , 852 - 863 . Liu Y , Schiff M , Dinesh-Kumar SP . 2002 . Virus-induced gene silencing in tomato . The Plant Journal 31 , 777 - 786 . Luo H , Dai SJ , Ren J , et al. 2014 . The role of ABA in the maturation and postharvest life of a nonclimacteric sweet cherry fruit . Journal of Plant Growth Regulation 33 , 373 - 383 . Ma Y , Szostkiewicz I , Korte A , Moes D , Yang Y , Christmann A , Grill E. 2009 . Regulators of PP2C phosphatase activity function as abscisic acid sensors . Science 324 , 1064 - 1068 . Melcher K , Ng LM , Zhou XE , et al. 2009 . A gate-latch-lock mechanism for hormone signalling by abscisic acid receptors . Nature 462 , 602 - 608 . Millar AA , Jacobsen JV , Ross JJ , Helliwell CA , Poole AT , Scofield G , Reid JB , Gubler F. 2006 . Seed dormancy and ABA metabolism in Arabidopsis and barley, the role of ABA 8ʹ-hydroxylase . The Plant Journal 45 , 942 - 954 . Nishimura N , Hitomi K , Arvai AS , Rambo RP , Hitomi C , Cutler SR , Schroeder JI , Getzoff ED. 2009 . Structural mechanism of abscisic acid binding and signaling by dimeric PYR1 . Science 326 , 1373 - 1379 . Nitsch LMC , Oplaat C , Feron R , Ma Q , Wolters-Arts M , Hedden P , Mariani C , Vriezen WH . 2009 . Abscisic acid levels in tomato ovaries are regulated by LeNCED1 and SlCYP707A1 . Planta 229 , 1335 - 1346 . Okamoto M , Kuwahara A , Seo M , Kushiro T , Asami T , Hirai N , Kamiya Y , Koshiba T , Nambara E. 2006 . CYP707A1 and CYP707A2, which encode abscisic acid 8′-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis . Plant Physiology 141 , 97 - 107 . Park SY , Fung P , Nishimura N , et al. 2009 . Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science 324 , 1068 - 1071 . Qin X , Zeevaart JAD . 1999 . The 9-cis-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in waterstressed bean . Proceedings of the National Academy of Sciences , USA 96 , 15354 - 15361 . Rabino I , Mancinelli AL . 1986 . Light, temperature, and anthocyanin production . Plant Physiology 81 , 922 - 924 . Ren J , Chen P , Dai SJ , Li P , Li Q , Ji K , Wang YP , Leng P. 2011 . Role of abscisic acid and ethylene in sweet cherry fruit maturation, molecular aspects . New Zealand Journal of Crop and Horticultural Science 39 , 1 - 14 . 2010. Cloning and expression analysis of cDNAs for ABA 8′-hydroxylase during sweet cherry fruit maturation and under stress conditions . Journal of Plant Physiology 167 , 1486 - 1493 . Saito S , Hirai N , Matsumoto C , Ohigashi H , Ohta D , Sakata K , Mizutani M. 2004 . Arabidopsis CYP707As encode (+)-abscisic acid 8′-hydroxylase, a key enzyme in the oxidative catabolism 1 of abscisic acid . Plant Physiology 134 , 1439 - 1449 . Schwartz SH , Qin XQ , Zeevaart JAD . 2003 . Elucidation of the indirect pathway of abscisic acid biosynthesis by mutants , genes, and enzymes. Plant Physiology 131 , 1591 - 1601 . Setha S , Kondo S , Hirai N , Ohigashi H. 2005 . Quantification of ABA and its metabolites in sweet cherries using deuterium-labeled internal standards . Plant Growth Regulation 45 , 183 - 188 . Shen XJ , Zhao K , Liu L , Kaichun Zhang , Huazhao Yuan , Xiong Liao , Qi Wang , Xinwei Guo , Fang Li , Tianhong Li . 2014 . A role for PacMYBA in ABA-regulated anthocyanin biosynthesis in red-colored sweet cherry cv . Hong Deng (Prunus avium L.). Plant and Cell Physiology 55 , 862 - 880 . Soto A. Ruiz KB , Ravaglia D , Costa G , Torrigiani P. 2013 . ABA may promote or delay peach fruit ripening through modulation of ripening- and hormone-related gene expression depending on the developmental stage . Plant Physiology and Biochemistry 64 , 11 - 24 . Sun L , Sun Y , Zhang M , et al. 2012a. Suppression of 9-cisepoxycarotenoid dioxygenase, which encodes a key enzyme in abscisic acid biosynthesis, alters fruit texture in transgenic tomato . Plant Physiology 158 , 283 - 298 . 2011. Transcriptional regulation of SlPYL, SlPP2C, and SlSnRK2 gene families encoding ABA signal core components during tomato fruit development and drought stress . Journal of Experimental Botany 62 , 5659 - 5669 . Sun L , Yuan B , Zhang M , Wang L , Cui MM , Wang Q , Leng P. 2012b . Fruit-specific RNAi-mediated suppression of SlNCED1 increases both lycopene and β-carotene contents in tomato fruit . Journal of Experimental Botany 63 , 3097 - 3108 . Sun L , Zhang M , Ren J , Qi JX , Zhang GJ , Leng P. 2010 . Reciprocity between abscisic acid and ethylene at the onset of berry ripening and after harvest . BMC Plant Biology 10 , 257 . Taylor IB , Sonneveld T , Bugg TDH , Thompson AJ . 2005 . Regulation and manipulation of the biosynthesis of abscisic acid, including the supply of xanthophyll precursors . Journal of Plant Growth Regulation 24 , 253 - 273 . Umezawa T , Okamoto M , Kushiro T , et al. 2006 . CYP707A3, a major ABA 8ʹ-hydroxylase involved in dehydration and rehydration response in Arabidopsis thaliana . The Plant Journal 46 , 171 - 182 . Wan CY , Wilkins TA . 1994 . A modified hot borate method significantly enhances the yield of high-quality RNA from cotton ( Gossypium hirsutum L.). Analytical Biochemistry 223 , 7 - 12 . Wang YP , Wang Y , Ji K , et al. 2013 . The role of abscisic acid in regulating cucumber fruit development and ripening and its transcriptional regulation . Plant Physiology and Biochemistry 64 , 70 - 79 . Wang YP , Chen P , Sun L , Li Q , Dai SJ , Sun YF , Kai WB , Zhang YS , Liang B , Leng P. 2015 . Transcriptional regulation of PaPYLs, PaPP2Cs, and PaSnRK2s during sweet cherry fruit development and in response to abscisic acid and auxin at onset of fruit ripening . Plant Growth Regulation 75 , 455 - 464 . Yoo SD , Gao Z , Cantini C , Loescher WH , Nocker SV . 2003 . Fruit ripening in sour cherry, changes in expression of genes encoding expansins and other cell-wall-modifying enzymes . Journal of the American Society for Horticulture Science 128 , 16 - 22 . Zhang L , Qiu ZM , Hu Y , et al. 2011 . ABA treatment of germinating maize seeds induces VP1 gene expression and selective promoter-associated histone acetylation . Physiologia Plantarum 143 , 287 - 296 . Zhang L , Hu Y , Yan SH , Li H , He SB , Huang M , Li LJ . 2012 . ABAmediated inhibition of seed germination is associated with ribosomal DNA chromatin condensation, decreased transcription, and ribosomal RNA gene hypoacetylation . Plant Molecular Biology 79 , 285 - 293 . Zhao SL , Qi JX , Duan CR , Sun L , Sun YF , Wang YP , Ji K , Chen P , Dai SJ , Leng P. 2012 . Expression analysis of the DkNCED1, DkNCED2, and DkCYP707A1 genes that regulate homeostasis of abscisic acid during the maturation of persimmon fruit . Journal of Horticultural Science and Biotechnology 87 , 165 - 171 .

This is a preview of a remote PDF:

Qian Li, Pei Chen, Shengjie Dai, Yufei Sun, Bing Yuan, Wenbin Kai, Yuelin Pei, Suihuan He, Bin Liang, Yushu Zhang, Ping Leng. PacCYP707A2 negatively regulates cherry fruit ripening while PacCYP707A1 mediates drought tolerance, Journal of Experimental Botany, 2015, 3765-3774, DOI: 10.1093/jxb/erv169