Streptococcus gallolyticus Pil3 Pilus Is Required for Adhesion to Colonic Mucus and for Colonization of Mouse Distal Colon

Journal of Infectious Diseases, Oct 2015

Streptococcus gallolyticus is an increasing cause of bacteremia and infective endocarditis in the elderly. Several epidemiological studies have associated the presence of this bacterium with colorectal cancer. We have studied the interaction of S. gallolyticus with human colonic cells. S. gallolyticus strain UCN34, adhered better to mucus-producing cells such as HT-29-MTX than to the parental HT-29 cells. Attachment to colonic mucus is dependent on the pil3 pilus operon, which is heterogeneously expressed in the wild-type UCN34 population. We constructed a pil3 deletion mutant in a Pil3 overexpressing variant (Pil3+) and were able to demonstrate the role of Pil3 pilus in binding to colonic mucus. Importantly, we showed that pil3 deletion mutant was unable to colonize mice colon as compared to the isogenic Pil3+ variant. Our findings establish for the first time a murine model of intestinal colonization by S. gallolyticus.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

http://jid.oxfordjournals.org/content/212/10/1646.full.pdf

Streptococcus gallolyticus Pil3 Pilus Is Required for Adhesion to Colonic Mucus and for Colonization of Mouse Distal Colon

JID Streptococcus gallolyticus Pil3 Pilus Is Required for Adhesion to Colonic Mucus and for Colonization of Mouse Distal Colon Mariana Martins 1 2 Laetitia Aymeric 0 Laurence du Merle 1 2 Camille Danne 1 2 Catherine Robbe-Masselot 3 Patrick Trieu-Cuot 1 2 Philippe Sansonetti 0 Shaynoor Dramsi 1 2 0 Department of Cell Biology and Infection, Molecular Microbial Pathogenesis Unit, Institut Pasteur , Paris 1 Department of Microbiology, Centre National de la Recherche Scientifique (CNRS) ERL3526 2 Department of Microbiology, Biology of Gram-Positive Pathogens Unit, Institut Pasteur 3 University Lille Nord, USTL, UGSF , Villeneuve d'Ascq , France Streptococcus gallolyticus is an increasing cause of bacteremia and infective endocarditis in the elderly. Several epidemiological studies have associated the presence of this bacterium with colorectal cancer. We have studied the interaction of S. gallolyticus with human colonic cells. S. gallolyticus strain UCN34, adhered better to mucus-producing cells such as HT-29-MTX than to the parental HT-29 cells. Attachment to colonic mucus is dependent on the pil3 pilus operon, which is heterogeneously expressed in the wild-type UCN34 population. We constructed a pil3 deletion mutant in a Pil3 overexpressing variant (Pil3+) and were able to demonstrate the role of Pil3 pilus in binding to colonic mucus. Importantly, we showed that pil3 deletion mutant was unable to colonize mice colon as compared to the isogenic Pil3+ variant. Our findings establish for the first time a murine model of intestinal colonization by S. gallolyticus. adhesion; colon; colonization; mucins; Pil3 pilus; S; bovis; S; gallolyticus - Streptococcus gallolyticus, formerly classified as S. bovis biotype I, is an emerging opportunistic pathogen responsible for septicemia and infective endocarditis in the elderly with underlying diseases [1–3]. This grampositive coccus is one of the few intestinal bacteria consistently linked to colorectal cancer (CRC) [4–10]. Numerous studies have shown that a colon tumor or polyp was detected upon full bowel examination in 33% to 90% of patients diagnosed with an S. gallolyticus infection. While fecal carriage of S. gallolyticus in the healthy population is relatively low, it increases about 5-fold in patients with CRC [4]. However, whether S. gallolyticus is a cause or a consequence of CRC remains to be determined [11, 12]. The first genome of S. gallolyticus strain UCN34 isolated from a patient suffering from endocarditis and thereafter diagnosed for colon cancer provided important insights on the adaptation and virulence strategies evolved by this bacterium [13]. It revealed the presence of 3 pilus operons, pil1, pil2, and pil3 [13]. We previously showed that Pil1 pilus is important for binding to collagen through the pilus-associated adhesin PilA and colonization of heart valves in a rat model of experimental endocarditis [14]. How S. gallolyticus interacts with the host colon is not known. Mucus is the first physical barrier that protects intestinal cells against microbial infection but is also used by commensals to interact with the host [15]. The pil3 locus of S. gallolyticus strain UCN34 is a likely candidate in this process because a bioinformatic analysis revealed the existence of a putative mucusbinding domain in the Pil3 associated adhesin encoded by gallo_2040. Pilus-like fibers on the surface of UCN34 were characterized by immunoblotting and immune electron microscopy using polyclonal antibodies against the two structural Pil3 pilin subunits (Gallo_2040 and Gallo_2039). Like pilus Pil1, Pil3 is heterogeneously expressed in the UCN34 population, with a majority of cells weakly piliated and a minority of cells highly piliated. We constructed a pil3 deletion mutant in a Pil3-overexpressing variant (Pil3+) and showed that Pil3 is involved in S. gallolyticus attachment to colonic mucus and that the adhesin Pil3A plays an essential role in this interaction. Furthermore, we demonstrated the requirement of Pil3 pilus for the colonization of mice colon in vivo, establishing for the first time a murine model of intestinal colonization by S. gallolyticus. Genetic Organization and Expression of the Pil3 Pilus in the Strain UCN34 In this study, the pil3 locus of S. gallolyticus UCN34 was characterized at the molecular level. As shown in Figure 1A, this locus is composed of 5 genes encoding 2 structural pilin subunits (gallo_2040 and gallo_2039), 1 sortase C enzyme (gallo_2038), 1 homolog of type 1 signal peptidase (gallo_2041), and 1 small open-reading frame (gallo_2042) of unknown function. This organization is reminiscent of many pilus operons described in gram-positive bacteria [16]. The structural proteins Gallo2040 (Pil3A) and Gallo2039 (Pil3B) are typical LPXTG proteins of 1664 and 478 amino acids, respectively; Pil3A being the putative adhesin and Pil3B the major pilin composing the pilus fiber. A search for conserved domains using Simple Modular Architecture Research Tool (SMART) software (EMBL) revealed the presence of a putative mucus-binding domain within the Pil3A protein (amino acids 1154 to 1238). Organization of the pil3 promoter region is similar to that of pil1, with a putative leader peptide encoding gene containing 13 GCAGA tandem repeats followed by a stem-loop transcription terminator (Figure 1A). We previously showed that this structure is involved in the heterogeneous expression of pil1 by a phase variation mechanism combined with transcriptional attenuation [17]. Pil3 pilus heterogeneity in S. gallolyticus strain UCN34 was first visualized by immunofluorescence using specific antibodies directed against the pilins Pil3A and Pil3B. As shown in Figure 1B, only a small proportion of the bacteria expressed the Pil3 pilus at a high level. An overexpressing variant (Pil3+) selected from the wild-type strain UCN34 [17] exhibited a higher proportion of cells expressing Pil3 pilus at a high level. Pil3 heterogeneous expression was further analyzed by flow cytometry and illustrated by the broad peak profile in the wild-type strain using specific anti-Pil3B antibody (Supplementary Figure 1A). Quantification of Pil3B levels in wild-type UCN34 indicated that approximately 70%–90% of the cells are weakly piliated (Pil3low) and 10%–30% highly piliated (Pil3high). The Pil3+ strain exhibited a sharper peak in flow cytometry experiment and a higher number of bacteria (approximately 95%) displayed high levels of Pil3 pilus. As negative control, we constructed a strain deleted for the entire pil3 locus (Δpil3) in the Pil3+ background. Pil3 pilus biogenesis was then assessed by Western blotting of cell wall protein extracts from S. gallolyticus UCN34, Pil3+, and Δpil3 using the specific antibodies against Pil3A and Pil3B pilins. As shown in Figure 1C, a typical laddering profile of highmolecular-weight polymers can be observed in the Pil3+ variant but not in the control Δpil3. Very low amount of Pil3 polymers was detected in UCN34, in agreement with the immunofluorescence and flow cytometry data. Antibodies produced against both Pil3A and Pil3B are highly specific, as demonstrated by the absence of high-molecular-weight reactive bands in Δpil3 protein extracts. Of note, a nonspecific band of 25 kDa was detected with both antibodies serving as a loading control. Finally, immunoelectron microscopy revealed the presence of typical pilus fiber structures in the Pil3+ variant that were not observed with the isogenic Δpil3 mutant (Figure 1D). Pil3 Promotes Bacterial Attachment to Colonic Mucus In Vitro Pili have long been considered important players in bacterial attachment to host tissues, an essential step in the pathogenic process. The presence of a putative mucus-binding domain in Pil3A led us to uncover the functional binding properties of this pilus. The capacity of S. gallolyticus UCN34, Pil3+, and Δpil3 mutant to adhere to the mucus recovered from HT29MTX was tested in vitro (Figure 2A). This human colonic cell line, upon differentiation for 15 to 20 days, is known to constitutively produce mucus [18, 19]. As shown in Figure 2A, the Pil3+ variant adheres more efficiently to mucus as compared to the parental UCN34 strain or the Δpil3 mutant. A similar result was obtained when using purified porcine gastric mucins (Figure 2B). No significant binding was observed when using bovine maxillary mucins (data not shown), suggesting some specificity in host mucins serving as Pil3 ligand. Furthermore, we analyzed the binding capacity of the same strains to purified human MUC5AC mucin. Likewise, the Pil3+ strain efficiently adhered to MUC5AC when compared to the Δpil3 mutant (Figure 2C). To test the role of Pil3A putative adhesin in bacterial attachment to mucus, we overexpressed gallo_2040 in the plasmid pTCV-erm using a strong constitutive promoter. Expression of the adhesin Pil3A in the Δpil3 (Pil3A) strain was demonstrated by flow cytometry (Supplementary Figure 1B) and immunofluorescence (Supplementary Figure 1C). As shown in Figure 2C, overexpression of Pil3A alone in S. gallolyticus Δpil3 mutant partially restored bacterial adhesion to HT29-MTX mucus as compared to the control Δpil3 strain harboring the empty vector (Δpil3(vector)). Furthermore, heterologous expression of Pil3A in Lactococcus lactis strain NZ9000 also conferred to the recombinant bacteria an enhanced capacity for binding to colonic mucus, as compared to the control L. lactis strain harboring the empty vector (Figure 2C). To further demonstrate the role of Pil3A in mucus binding, we tested several clinical strains of S. gallolyticus from our collection, both for expression of Pil3A and binding to mucus derived from HT29-MTX cells. Because Pil3 expression is heterogeneous and subjected to phase variation, the experiments were carried out in parallel. A robust correlation (r = 0.97; P <.0001) was observed between the level of Pil3A expression measured by flow cytometry and the binding capacity of the various S. gallolyticus strains to HT29-MTX mucus (Figure 2D). Role of Pil3 in Primary Attachment to Human Mucus-Producing Cells We next investigated the role of Pil3 pilus in adhesion to colonic epithelial cells in the presence or absence of mucus. We compared adhesion of S. gallolyticus UCN34, Pil3+, and Δpil3 strains to the mucus-producing HT29-MTX cells and to the parental HT29 cell line that does not produce mucus. Both types of cells were grown on coverslips for 2 weeks before infection with the 3 strains. Preliminary adhesion experiments on Caco-2 cells indicated that efficient adhesion of S. gallolyticus occurred at 4 hours postinfection with a significant increase at 6 hours. We therefore chose to image S. gallolyticus adhesion to HT29-MTX and HT29 at 6 hours postinfection by confocal microscopy using an antibody raised against the whole bacterium UCN34. We first verified that the 3 strains of S. gallolyticus, UCN34, Pil3+, and Δpil3, grew similarly in the conditioned cell culture medium from both cell types (data not shown). Interestingly, both UCN34 and Pil3+ variant attached very efficiently to HT29-MTX cells, whereas the Δpil3 mutant was unable to bind these cells (Figure 3A). Strikingly, all 3 S. gallolyticus strains bound very weakly to the HT29 parental cells (Figure 3A, lower panel). Quantification of the fluorescence signal from adherent bacteria is shown in Figure 3B. The results unambiguously demonstrate the role of Pil3 in the attachment of S. gallolyticus to colonic mucus-producing cells. All together, these in vitro results strongly point to the importance of Pil3 pilus in bacterial adhesion to colonic mucus and subsequently in the establishment of a direct interaction with mucus-producing cells. Pil3 Pilus Is Critical for Colonization of the Mouse Gastrointestinal Tract We next wondered whether S. gallolyticus Pil3 pilus could contribute to colonization of the colon in vivo. To address this question, we established for the first time an in vivo model of gastrointestinal colonization for S. gallolyticus in mice. Following oral inoculation of S. gallolyticus, we were able to quantify living bacteria in intestinal tissues using selective culture media. To increase gastrointestinal colonization by S. gallolyticus, specific pathogen-free mice were first treated with broad-spectrum antibiotics to reduce mice endogenous gut microbiota, as described previously [20], thus enhancing UCN34 colonization by 3 logs (data not shown). We then compared colonization efficiency of S. gallolyticus reference strain UCN34 in 2 different mice strains: BALB/c and C57BL/6J. The colonization was 10 times more efficient in the C57BL/6 mouse background (data not shown). Using this optimized protocol in C57BL/6 mice, we compared colonization efficiencies of S. gallolyticus strain UCN34, Pil3+ variant, and Δpil3 deletion mutant in different parts of the gastrointestinal tract, including the ileum and distal colon. A representative experiment with 5 mice in each group, analyzed for colony-forming unit (CFU) quantification (Figure 4A) and by immunohistochemistry (Figure 4B), is shown in Figure 4. We found that the Δpil3 mutant was significantly impaired, with a 2-log difference, in distal colon colonization compared to the Pil3+ variant. UCN34 was able to colonize at an intermediate level between Pil3+ and Δpil3, in agreement with the smaller proportion of bacteria expressing pil3 in UCN34. To determine the localization of S. gallolyticus in vivo, immunohistochemistry was performed using a polyclonal antibody raised against UCN34 to label bacteria and wheat germ agglutinin (WGA) to visualize the colonic mucus layer. As shown in Figure 3B, most Pil3+ bacteria were found both in the lumen and also tightly associated to the colonic mucus layer. In contrast, the Δpil3 mutant was only found in the lumen of the gastrointestinal (GI) tract (data not shown) and in much lower number (Figure 4B, right lower panel), in agreement with the CFU counts. These results demonstrate the role of Pil3 pilus in the colonization of mouse distal colon by S. gallolyticus. DISCUSSION Streptococcus gallolyticus belongs to the Streptococcus bovis/ Streptococcus equinus complex, a highly diverse group of nonhemolytic streptococci that are intestinal commensals, opportunistic pathogens, and food fermentation associates [3]. It is an emerging human pathogen that causes infective endocarditis and is consistently associated with colorectal carcinomas [10]. Current medical recommendations advise to perform a colonoscopy for any patient diagnosed with S. gallolyticus– associated disease. In the present study, we carried out the molecular and functional characterization of the pil3 locus (gallo2042-2038) encoding a putative mucus binding protein. The pil3 locus is highly conserved and present in all 31 clinical strains of S. gallolyticus analyzed previously [21]. Basic Local Alignment Search Tool (BLAST) analyses revealed the presence of the pil3 operon in S. pasteurianus and in S. macedonicus [22–24]. Pil3 pilus of S. gallolyticus strain UCN34 consists of 2 structural subunits—Pil3B, the major pilin, and Pil3A, the pilus associated adhesin—that are covalently assembled by a class C sortase (encoded by gallo_2038). Single-cell analyses demonstrated that Pil3 is expressed heterogeneously in the UCN34 population by a mechanism of phase variation previously characterized [17]. By selecting a phenotypic variant expressing higher amount of pili (Pil3+) and by constructing a pil3 deletion mutant in this variant, we were able to demonstrate the role of Pil3 pilus in the attachment to colonic mucus of HT29MTX cells. Overexpression of Pil3A in the S. gallolyticus pil3 mutant or in the heterologous L. lactis enhanced bacterial binding to the colonic mucus in vitro, indicating that Pil3A contributes to the mucus-binding function. Of note, Pil3 also conferred binding to pig gastric mucins (Figure 2B), to purified MUC5AC mucin (Figure 2C), but not to bovine maxillary mucins (data not shown). HT29-MTX mucus is highly enriched in MUC5AC mucin [25] and devoid of MUC2 (data not shown). While MUC2 is the predominant mucin in healthy colon, MUC5AC is not detected in normal conditions, but is frequently overexpressed in adenomas and colon cancers [26]. Interestingly, pig gastric mucins, which act as ligand for Pil3, react with monoclonal antibodies against human MUC5AC but not with MUC2. In contrast, bovine maxillary mucins, which are not permissive for Pil3 binding, did not react with MUC5AC monoclonal antibody and only gave a faint signal with MUC2 (data not shown). Finally, we demonstrated that Pil3 binds specifically to purified MUC5AC mucin (Figure 2C), which may explain the low carriage rate of S. gallolyticus in healthy colon of the human population, and the higher carriage in the presence of a colon tumor. Importantly, we established for the first time a mouse model to study gut colonization by S. gallolyticus and were able to show that Pil3 promotes bacteria attachment to the distal colon. Histopathological analyses further demonstrated that S. gallolyticus expressing a high level of Pil3 mainly colocalized with the mice colonic mucus, whereas the Δpil3 mutant, present in much lower numbers, was found mainly in the lumen and barely associated to the mucus layer (Figure 4). Other examples of pili from gram-positive bacteriapromoting gut colonization are found in beneficial commensals of the GI tract, such as lactobacilli and bifidobacteria [27]. In particular, the SpaCBA pilus of the probiotic Lactobacillus rhamnosus GG is involved in binding to human mucus via the adhesin SpaC [28]. Interestingly, SpaC was found along the whole pilus length, allowing both short- and long-distance interactions with the host tissues, thus providing mucusbinding strength to persist longer in the gastrointestinal tract [29]. In conclusion, we identified and characterized the Pil3 pilus of S. gallolyticus as a novel factor required for bacterial adhesion to human colonic mucus and for colon colonization in the mouse model. MATERIAL AND METHODS Cell Culture and Bacterial Strains The mucus-secreting HT29-MTX cell subpopulation [18] and the parental HT29 cells were routinely grown in Dulbecco’s modified Eagle medium supplemented with 10% heat-inactivated fetal bovine serum. S. gallolyticus strains were grown at 37°C in Todd-Hewitt (TH) broth in standing filled flasks. Lactococcus lactis strains were grown in M17 medium containing 1% glucose. Erythromycin and tetracycline were used at 10 µg/mL for S. gallolyticus, and erythromycin was used at 150 µg/mL for Escherichia coli. A Pil3 pilus-overexpressing strain (Pil3+) was selected from the wild-type UCN34 by immunolabeling screening as previously described [17]. We have constructed a pil3 deletion mutant in the Pil3+ strain background ( from gallo_2042 to gallo_2038) as described previously [30]. The primers used are listed in Table 1. Expression and Purification of Recombinant 6×His-Gallo2039 and 6×His-Gallo2040 N-terminus DNA fragments internal to gallo_2039 and gallo_2040 were produced by polymerase chain reaction using genomic DNA of UCN34 as template and the primers gallo2039-NdeI and gallo2039-BamHI, and gallo2040-NheI and gallo2040-BamHI, respectively (Supplementary Table 1). These DNA fragments were digested with the appropriate enzymes and cloned into pET28-a(+) (Novagen). The resulting plasmids were introduced into E. coli strain DH5α for sequence analysis or BL21 (λDE3) for protein expression. Recombinant 6×HisGallo2039 and 6×His-Gallo2040 Nter were purified under native conditions by affinity chromatography on nickel-charged nitrilotriacetic acid (Ni-NTA) columns according to the manufacturers’ recommendations (Novagen). Protein purity was checked on sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and accurate protein concentrations were determined with the bicinchoninic acid (BCA) system (Pierce). Primers Abbreviation: bp, base pair. Generation of Rabbit and Mice Polyclonal Antibodies Rabbit polyclonal antibodies against Gallo_2039 (Pil3B) and Gallo_2040 (Pil3A) were generated by Covalab, Villeurbanne, France (www.covalab.com). Rabbit serum samples were further purified using the Melon Gel IgG Spin Purification Kit (Thermo Scientific Pierce). Immunofluorescence and Flow Cytometry Experiments These experiments were performed exactly as described previously [17] except that coverslips were mounted with ProLong Gold Antifade (Life Technologies) and imaged on a Nikon Eclipse Ni-U microscope. Confocal Microscopy HT29 and HT29-MTX were cultured in coverslips for 16 days and infected with S. gallolyticus isogenic strains UCN34, Pil3+, and Δpil3 at a multiplicity of infection of 5 bacteria per cell. After 6 hours of infection, cells were washed once in phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde (PFA) for 10 minutes. Infected cells were then stained with 1:200 anti-UCN34 antibody (Covalab, France), followed by secondary DyLight488 conjugated antirabbit antibody (1:200) to stain specifically S. gallolyticus. Hoescht 33 342 (1:2000) was added to visualize cells nuclei and Alexa Fluor 647 phalloidin (1:50) to stain the actin cytoskeleton. Samples were mounted using the ProLong Gold Antifade reagent and visualized using a Leica TCS SP5 confocal microscope. Maximum projections and total fluorescence measurements were performed with Image J. Cell Wall Protein Extraction Bacteria were grown overnight in TH broth and harvested for protein analysis during the late-exponential phase of cultures as described previously [14]. When necessary, cell wall extracts were concentrated using trichloroacetic acid (TCA) protein precipitation. Samples were incubated with 7% TCA for 30 minutes on ice washed with acetone and resuspended in PBS for quantification. Protein extracts were boiled in Laemmli buffer and Sequence 5′ → 3′ Amplified Fragment CAGAATTCTCAATGGTTTATTTTGAATG TAGCTTTCCTAATTCATAGAGTTCTTTACCTTTTC GAAAAGGTAAAGAACTCTATGAATTAGGAAAGCTA GTTTGGGATCCTATTTACCTCTTTCTTAC GCAGTACATATGCAAACAGTTGACTCAGGT CCAAAGGATCCTCATGAAGGCAATTCTGCACC ATAGTGCTAGCGCCAATCAAACGCCTGGTA TTTATGGATCCAGTATTAGCTTTCCATTCT further analyzed on SDS-PAGE. Midi Criterion XT Precast gel (4%–12% Bis-Tris; Bio-Rad) were used and transferred to nitrocellulose membrane using the Trans-Blot Turbo transfer Pack, Bio-Rad. Membrane was blocked in TBS–skimmed milk 5% and incubated for 1 hour with rabbit primary Pil3B and Pil3A antibodies and then with the secondary Dylight800coupled goat antirabbit antibody (Thermo Scientific Pierce). Far-red fluorescence was detected using the LI-COR Odyssey Infrared Imaging System (LI-COR Biosciences). Mucus Adhesion Assay Colonic mucus was recovered from HT29-MTX cells upon 16 to 20 days in culture and quantified using BCA assay (Thermo Scientific, Pierce). Polystyrene Maxisorp (NUNC) plates (96-wells) were precoated overnight with 5 µg/well of either MTX mucus or porcine stomach mucins (Sigma Ref. M1778). Overnight cultures grown in TH were washed once with 1× PBS and 100 µL of cell suspension at optical density (600 nm) of two were added to each well. Two were added to each well with further incubation at 37°C for 2 hours. After 2 consecutive washes, the bacteria were stained with 0.1% crystal violet for 30 minutes, washed twice, and airdried for 15 minutes. Stained bacteria were resuspended for quantification in ethanol/acetone solution (80:20) and absorbance was measured at 595 nm. Mice Colonization Experiments All animal experiments were carried out under approval by the Use Committee of Pasteur Institute and by the French Ministry of Agriculture (Ethic committee protocol number: 2013-0030). BALB/c and C57BL/6J Rj mice were obtained from Janvier Labs (Le Genest-Saint-Isle, France) and maintained in a pathogenfree area. Based on a published protocol [20], 8-week-old mice were treated with broad-spectrum antibiotics, including vancomycin, metronidazole, neomycin, and ampicillin, for 8 days. Using a straight feeding cannula (Bioseb N-020), mice were orally inoculated with 2 × 109 exponentially growing bacteria on 3 consecutive days. Bacterial colonization was determined 7 days postinfection by CFU counts. Briefly, mice were euthanized, and tissues were harvested, weighted, and homogenized using Precellys homogenizer (Ozyme) for 2 × 15 seconds at a frequency of 5000 rpm. Samples were diluted in saline and plated on Enterococcus agar selective media (BD Difco) for specific counting of S. gallolyticus exhibiting a typical pink color as previously described [7]. This experiment was repeated twice with a minimum of 5 mice per group each time. Immunocytochemistry of Mouse Tissues Mouse tissues recovered 7-day postinfection were fixed for 48 hours in PBS-PFA 4% and embedded in paraffin following routine procedures. Serial sections were permeabilized with 0.1% Triton X-100 for 30 minutes and blocked for 5 minutes with Ultra V block (Thermo Scientific). Samples were incubated for 1 hour in PBS-10% Ultra V block with rabbit anti-UCN34 (1:200). Secondary Alexa Fluor 568-conjugated goat antirabbit antibody (1:200, Life Technologies) and WGA-coupled to Alexa Fluor 488 (1:200, Life Technologies) in PBS-10% Ultra V block were added and samples were incubated for 45 minutes at room temperature. The tissue preparations were then incubated with 4’,6-diamidino-2-phenylindole (1:1000) in PBS for 3 minutes and mounted with ProLong Gold Antifade reagent. Sections were imaged on a Cell Voyager CV1000 confocal scanner box and fluorescence images were processed using Fiji software. Supplementary Data Supplementary materials are available at The Journal of Infectious Diseases online (http://jid.oxfordjournals.org). Supplementary materials consist of data provided by the author that are published to benefit the reader. The posted materials are not copyedited. The contents of all supplementary data are the sole responsibility of the authors. Questions or messages regarding errors should be addressed to the author. Acknowledgments. We sincerely thank Prof Alain Servin and Virginie Liévin-Le Moal (Faculty of Pharmacy, Chatenay-Malabry, France) for providing the cell lines HT29 and HT29-MTX. We are grateful to Adeline Mallet from the Platform of Ultrastructural Microscopy for the electron microscopy experiments. We also thank Jean-Yves Tivenez from the Imagopole-Plateforme d’Imagerie Dynamique (PFID) France–BioImaging infrastructure, supported by the French National Research Agency (ANR 10-INSB-04-01, Investments for the Future), for advice and access to the CV1000 system. We thank Claire Poyart, head of the CNR-Strep for providing clinical strains of S. gallolyticus. Financial support. This work was supported by the French National Research Agency (ANR) Blanc Glyco-Path (grant n°ANR-10_BLANC1314), by the Foundation for Medical Research (FRM), and from the French Government’s Investissement d’Avenir Program, Laboratoire d’Excellence “Integrative Biology of Emerging Infectious Diseases” (grant n°ANR-10LABX-62-IBEID). M. M. was supported by a stipend from the Pasteur–Paris University (PPU) International PhD Program and by a 1-year extension fellowship from the Association pour la Recherche sur le Cancer (ARC) Foundation (01CA140068-ARC-MARTINS). L. A. was supported by “La Ligue nationale contre le cancer.” Potential conflicts of interest. All authors: No reported conflicts. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed. 1. Watanakunakorn C. Streptococcus bovis endocarditis . Am J Med 1974 ; 56 : 256 - 60 . 2. Schlegel L. Reappraisal of the taxonomy of the Streptococcus bovis/Streptococcus equinus complex and related species: description of Streptococcus gallolyticus subsp. gallolyticus subsp . nov., S. gallolyticus subsp . macedonicus subsp. nov. and S. gallolyticus subsp. Int J Syst Evol Microbiol 2003 ; 53 : 631 - 45 . 3. Jans C , Meile L , Lacroix C , Stevens MJ . Genomics, evolution, and molecular epidemiology of the Streptococcus bovis/Streptococcus equinus complex (SBSEC). Infect Genet Evol 2015 ; 33 : 419 - 36 . 4. Klein RS , Recco RA , Catalano MT , Edberg SC , Casey JI , Steigbigel NH . Association of Streptococcus bovis with carcinoma of the colon . N Engl J Med 1977 ; 297 : 800 - 2 . 5. Ellmerich S , Schöller M , Duranton B , et al. Promotion of intestinal carcinogenesis by Streptococcus bovis . Carcinogenesis 2000 ; 21 : 753 - 6 . 6. Gupta A , Madani R , Mukhtar H. Streptococcus bovis endocarditis, a silent sign for colonic tumour . Colorectal Dis 2009 ; 12 : 164 - 71 . 7. Abdulamir A , Hafidh R , Bakar F. Molecular detection, quantification, and isolation of Streptococcus gallolyticus bacteria colonizing colorectal tumors: inflammation-driven potential of carcinogenesis via IL-1, COX-2, and IL-8. Mol Cancer 2010 ; 249 : 1 - 18 . 8. Boleij A , Muytjens CMJ , Bukhari SI , et al. Novel clues on the specific association of Streptococcus gallolyticus subsp gallolyticus with colorectal cancer . J Infect Dis 2011 ; 203 : 1101 - 9 . 9. Boleij A , Tjalsma H. The itinerary of Streptococcus gallolyticus infection in patients with colonic malignant disease . Lancet Infect Dis 2013 ; 13 : 719 - 24 . 10. Boleij A , van Gelder MMHJ , Swinkels DW , Tjalsma H. Clinical Importance of Streptococcus gallolyticus infection among colorectal cancer patients: systematic review and meta-analysis . Clin Infect Dis 2011 ; 53 : 870 - 8 . 11. zur Hausen H. Streptococcus bovis: causal or incidental involvement in cancer of the colon ? Int J Cancer 2006 ; 119:xi-xii . 12. Hensler ME . Streptococcus gallolyticus, infective endocarditis, and colon carcinoma: new light on an intriguing coincidence . J Infect Dis 2011 ; 203 : 1040 - 2 . 13. Rusniok C , Couvé E , Da Cunha V , et al. Genome sequence of Streptococcus gallolyticus: insights into its adaptation to the bovine rumen and its ability to cause endocarditis . J Bacteriol 2010 ; 192 : 2266 - 76 . 14. Danne C , Entenza JM , Mallet A , et al. Molecular characterization of a Streptococcus gallolyticus genomic island encoding a pilus involved in endocarditis . J Infect Dis 2011 ; 204 : 1960 - 70 . 15. Johansson M. The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host-microbial interactions . Proc Natl Acad Sci USA 2011 ; 108 (suppl): 4659 - 65 . 16. Danne C , Dramsi S. Pili of Gram-positive bacteria: roles in host colonization . Res Microbiol Elsevier Masson SAS 2012 ; 163 : 645 - 58 . 17. Danne C , Dubrac S , Trieu-Cuot P , Dramsi S. Single cell stochastic regulation of pilus phase variation by an attenuation-like mechanism . PLOS Pathog 2014 ; 10 :e1003860. 18. Lesuffleur T , Barbat A , Dussaulx E , Zweibaum A. Growth adaptation to methotrexate of HT-29 human colon carcinoma cells is associated with their ability to differentiate into columnar absorptive and mucus-secreting cells . Cancer Res 1990 ; 50 : 6334 - 43 . 19. Lesuffleur T , Violette S , Vasile-Pandrea I , et al. Resistance to high concentrations of methotrexate and 5-fluorouracil of differentiated HT-29 colon-cancer cells is restricted to cells of enterocytic phenotype . Int J Cancer 1998 ; 76 : 383 - 92 . 20. Reikvam DH , Erofeev A , Sandvik A , et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression . PLOS One 2011 ; 6 : 1 - 13 . 21. Sillanpää J , Nallapareddy SR , Qin X , et al. A collagen-binding adhesin, Acb, and ten other putative MSCRAMM and pilus family proteins of Streptococcus gallolyticus subsp. gallolyticus (Streptococcus bovis group, biotype I) . J Bacteriol 2009 ; 191 : 6643 - 53 . 22. Lin I-H , Liu T-T , Teng Y-T , et al. Sequencing and comparative genome analysis of two pathogenic Streptococcus gallolyticus subspecies: genome plasticity, adaptation and virulence . PLOS One 2011 ; 6 : e20519 . 23. Jans C , Follador R , Hochstrasser M , Lacroix C , Meile L , Stevens MJA . Comparative genome analysis of Streptococcus infantarius subsp. infantarius CJ18, an African fermented camel milk isolate with adaptations to dairy environment . BMC Genomics 2013 ; 14 : 200 . 24. Papadimitriou K , Anastasiou R , Mavrogonatou E , et al. Comparative genomics of the dairy isolate Streptococcus macedonicus ACA-DC 198 against related members of the Streptococcus bovis/Streptococcus equinus complex . BMC Genomics 2014 ; 15 : 272 . 25. Gouyer V , Wiede A , Buisine M. Specific secretion of gel-forming mucins and TFF peptides in HT-29 cells of mucin-secreting phenotype . Biochem Biophys Acta 2001 ; 1539 : 71 - 84 . 26. Byrd J , Bresalier R. Mucins and mucin binding proteins in colorectal cancer . Cancer Metastasis Rev 2004 ; 23 : 77 - 99 . 27. Ventura M , Turroni F , van Sinderen D. Probiogenomics as a tool to obtain genetic insights into adaptation of probiotic bacteria to the human gut . Bioeng Bugs 2012 ; 3 : 73 - 9 . 28. Kankainen M , Paulin L , Tynkkynen S , et al. Comparative genomic analysis of Lactobacillus rhamnosus GG reveals pili containing a humanmucus binding protein . Proc Natl Acad Sci USA 2009 ; 106 : 17193 - 8 . 29. Reunanen J , von Ossowski I , Hendrickx APA , Palva A , de Vosa WM . Characterization of the SpaCBA pilus fibers in the probiotic Lactobacillus rhamnosus GG . Appl Environ Microbiol 2012 ; 78 : 2337 - 44 . 30. Danne C , Guérillot R , Glaser P , Trieu-Cuot P , Dramsi S. Construction of isogenic mutants in Streptococcus gallolyticus based on the development of new mobilizable vectors . Res Microbiol 2013 ; 164 : 973 - 8 .


This is a preview of a remote PDF: http://jid.oxfordjournals.org/content/212/10/1646.full.pdf

Mariana Martins, Laetitia Aymeric, Laurence du Merle, Camille Danne, Catherine Robbe-Masselot, Patrick Trieu-Cuot, Philippe Sansonetti, Shaynoor Dramsi. Streptococcus gallolyticus Pil3 Pilus Is Required for Adhesion to Colonic Mucus and for Colonization of Mouse Distal Colon, Journal of Infectious Diseases, 2015, 1646-1655, DOI: 10.1093/infdis/jiv307