Erratum to: Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

Pneumonia, Jul 2017

Feroze A. Ganaie, Vandana Govindan, K. L. Ravi Kumar

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

https://link.springer.com/content/pdf/10.1186%2Fs41479-017-0034-1.pdf

Erratum to: Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

Erratum to: Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Feroze A. Ganaie 0 1 2 Vandana Govindan 0 1 2 K. L. Ravi Kumar 0 1 2 0 Hospital and Research Centre , Bangalore -560004 , India 1 Department of Microbiology, Kempegowda Institute of Medical Science 2 Ganaie FA, Govindan V, Ravi Kumar KL. Standardisation and evaluation of a 1. quantitative multiplex real-time PCR assay for the rapid identification of - 559. Streptococcus pneumonia Erratum GAPDH-probe. The error: In the publication of this article [1], there was an error in Table 1 which has a wrong sequence value at the ‘5′-Quasar 670–CTCAAGTTGGAAACCACGAGTAA GAGTGATGAA-3′-BHQ-2’. Should instead read: ‘5′-Quasar 670– CAAGCTTCCCGTTCTCAGCC-3′ This has now been included in this erratum.


This is a preview of a remote PDF: https://link.springer.com/content/pdf/10.1186%2Fs41479-017-0034-1.pdf

Feroze A. Ganaie, Vandana Govindan, K. L. Ravi Kumar. Erratum to: Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae, Pneumonia, 2017, 10, DOI: 10.1186/s41479-017-0034-1