Prevalence of ESBL-producing Pseudomonas aeruginosa isolates in Warsaw, Poland, detected by various phenotypic and genotypic methods

PLOS ONE, Jun 2017

Knowledge of the prevalence of ESBL enzymes among P. aeruginosa strains compared to the Enterobacteraiceae family is limited. The phenotypic tests recommended by EUCAST for the detection of ESBL-producing Enterobacteriaceae are not always suited for P. aeruginosa strains. This is mainly due to the presence of other families of ESBLs in P. aeruginosa isolates more often than in Enterobacteriaceae, production of natural AmpC cephalosporinase and its overexpression, and co-production of metallo-β-lactamases. The aim of this study was to determine the occurrence of ESBLs in P. aeruginosa isolated from patients from hospitals in Warsaw, to evaluate the ESBL production of these isolates using currently available phenotypic tests, their modifications, multiplex PCR and molecular typing of ESBL-positive isolates by PFGE. Clinical isolates of P. aeruginosa were collected in 2000-2014 from four Warsaw hospitals. Based on the data obtained in this study, we suggest using three DDST methods with inhibitors, such as clavulanic acid, sulbactam and imipenem, to detect ESBL-producing P. aeruginosa strains. Depending on the appearance of the plates, we suggest a reduction in the distance between discs with antibiotics to 15 mm and the addition of boronic acid at 0.4 mg per disc. The analysed isolates carried genes encoding ESBL from the families VEB (69 isolates with VEB-9), GES (6 with GES-1, 1 GES-5, 5 GES-13 and 2 with GES-15), OXA-2 (12 with OXA-15, 1 OXA-141, 1 OXA-210, 1 OXA-543 and 1 with OXA-544) and OXA-10 (5 isolates with OXA-74 and one with OXA-142). The most important result of this study was the discovery of three new genes, blaGES-15, blaOXA-141 and blaOXA-142; their nucleotide sequences have been submitted to the NCBI GenBank. It is also very important to note that this is the first report on the epidemiological problem of VEB-9-producing bacterial strains, not only in Poland but also worldwide.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

http://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0180121&type=printable

Prevalence of ESBL-producing Pseudomonas aeruginosa isolates in Warsaw, Poland, detected by various phenotypic and genotypic methods

June Prevalence of ESBL-producing Pseudomonas aeruginosa isolates in Warsaw, Poland, detected by various phenotypic and genotypic methods Agnieszka E. Laudy 1 2 Patrycja Ro g 1 2 Katarzyna Smolińska-Kr oÂl 1 2 Milena C miel 1 2 Alicja Søoczyńska 1 2 Jan Patzer 0 2 Danuta Dzierżanowska 0 2 Renata Wolinowska 1 2 Bohdan Starościak 1 2 Stefan Tyski 1 2 0 Department of Clinical Microbiology and Immunology, The Children's Memorial Health Institute , Warsaw , Poland , 3 Department of Antibiotics and Microbiology, National Medicines Institute , Warsaw , Poland 1 Department of Pharmaceutical Microbiology, Medical University of Warsaw , Warsaw , Poland 2 Editor: ConcepcioÂn Gonzalez-Bello, Universidad de Santiago de Compostela , SPAIN Knowledge of the prevalence of ESBL enzymes among P. aeruginosa strains compared to the Enterobacteraiceae family is limited. The phenotypic tests recommended by EUCAST for the detection of ESBL-producing Enterobacteriaceae are not always suited for P. aeruginosa strains. This is mainly due to the presence of other families of ESBLs in P. aeruginosa isolates more often than in Enterobacteriaceae, production of natural AmpC cephalosporinase and its overexpression, and co-production of metallo-β-lactamases. The aim of this study was to determine the occurrence of ESBLs in P. aeruginosa isolated from patients from hospitals in Warsaw, to evaluate the ESBL production of these isolates using currently available phenotypic tests, their modifications, multiplex PCR and molecular typing of ESBL-positive isolates by PFGE. Clinical isolates of P. aeruginosa were collected in 20002014 from four Warsaw hospitals. Based on the data obtained in this study, we suggest using three DDST methods with inhibitors, such as clavulanic acid, sulbactam and imipenem, to detect ESBL-producing P. aeruginosa strains. Depending on the appearance of the plates, we suggest a reduction in the distance between discs with antibiotics to 15 mm and the addition of boronic acid at 0.4 mg per disc. The analysed isolates carried genes encoding ESBL from the families VEB (69 isolates with VEB-9), GES (6 with GES-1, 1 GES-5, 5 GES-13 and 2 with GES-15), OXA-2 (12 with OXA-15, 1 OXA-141, 1 OXA-210, 1 OXA543 and 1 with OXA-544) and OXA-10 (5 isolates with OXA-74 and one with OXA-142). The most important result of this study was the discovery of three new genes, blaGES-15, blaOXA-141 and blaOXA-142; their nucleotide sequences have been submitted to the NCBI GenBank. It is also very important to note that this is the first report on the epidemiological problem of VEB-9-producing bacterial strains, not only in Poland but also worldwide. - Data Availability Statement: All relevant data are with the paper file. Funding: The study was funded partially by a grant from the State Committee for Scientific Research (KBN) ªThe presence of extended-spectrum betalactamases among the drug-resistant isolates of Pseudomonas aeruginosaº (grant no. 2PO5D 018 30), AEL, JP, DD, RW, BS, and Foundation for the Development of Diagnostics and Therapy, Warsaw, Poland. REGON:006220910, NIP:5262173856, KRS:0000195643, AEL, ST, and Medical University of Warsaw, statutory funds, AEL, ST. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Introduction Pseudomonas aeruginosa belongs to the group of ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter species) that are common causes of life-threatening nosocomial infections among immunocompromised and critically ill patients [ 1 ]. Clinical strains of P. aeruginosa resistant to many classes of antimicrobial agents, including β-lactams, aminoglycosides and fluoroquinolones, are often isolated [ 2 ]. However, an increase in strains resistant to the third- and fourth-generation cephalosporins and carbapenems has become a serious clinical problem worldwide. The primary cause of cephalosporin resistance in P. aeruginosa isolates is the overexpression of the chromosomal AmpC enzyme (mainly resistant to ceftazidime) and the production of the metallo-β-lactamases, MBLs (resistant to cephalosporins and carbapenems) [ 3,4 ]. However, ESBL-positive P. aeruginosa strains that produce extended-spectrum-βlactamases (ESBLs) are frequently isolated [ 2,5 ]. Recently, strains harbouring both blaESBL and blaMBL genes were also described [ 3,6 ]. At first, the occurrence of ESBL enzymes was associated with K. pneumoniae strains, which cause nosocomial outbreaks in intensive care units [7]. To date, the different Gram-negative rod species from the Enterobacteriaceae family are still the most frequently isolated ESBL-producing strains worldwide [ 8 ]. Generally, ESBLs are a group of β-lactamases that hydrolyse penicillins and cephalosporins, including oxyimino-βlactams (third- and fourth-generation of cephalosporins) and aztreonam, and are inhibited by β-lactamase inhibitors, such as clavulanic acid, sulbactam and tazobactam [ 7 ]. The features of these enzymes are utilized in the phenotypic tests used for the detection of ESBL-producing strains. All ESBL-type enzymes are categorized into two structural Ambler classes, A and D. In P. aeruginosa strains, the ESBL enzymes from both these classes are observed, primarily β-lactamases from the PER, GES [ 2,9 ], VEB [ 2,10 ], BEL [ 2,11,12 ], and PME [ 13 ] family (belonging to class A) and from the OXA family (class D), named extended-spectrum class D β-lactamases (ES-OXAs) [ 2,5,10 ]. Additionally, in a few P. aeruginosa isolates, the presence of ESBLs typical to the Enterobacteriaceae family, such as TEM, SHV [ 2,3 ] and CTX-M-type [2], was described. It is important that both American (CLSI) [ 14 ] and European (EUCAST) [ 15 ] recommendations concern the detection of ESBL enzymes by phenotypic tests only in the Enterobacteriaceae family. Indeed, by far the most clinically important groups of ESBLs are CTX-M enzymes, followed by the SHV- and TEM-derived ESBLs that are commonly found in Enterobacteriaceae [ 7,16 ]. In both these international recommendations, the confirmation of ESBL production should be performed using a combination disk test (CDT) or its equivalent, the broth microdilution test [ 14,15 ]. Additionally, the EUCAST recommendations allow the use of a double-disk synergy test (DDST) [ 15 ]. However, in all these phenotypic methods, only clavulanic acid as the β-lactamase inhibitor is recommended. The clinical strains of P. aeruginosa produce different families of ESBLs than the Enterobacteriaceae strains. Furthermore, some ES-OXAs are less well inhibited by the known β-lactamase inhibitors than ESBLs from class A [ 5 ]. In the case of P. aeruginosa, the presence of inducible chromosomal AmpC β-lactamase or its overexpression is also important. AmpC β-lactamases belonging to class C cephalosporinases contribute to the intrinsic resistance of P. aeruginosa to penicillin, some cephalosporins (excluding cefepime and ceftazidime) and β-lactams with β-lactamase inhibitors [ 2 ]. The level of AmpC production by P. aeruginosa isolates may interfere with or even hide the detection of ESBLs by phenotypic tests [ 17,18 ]. On the other hand, the most microbiological laboratories in the large hospitals, where the infection of P. aeruginosa ESBL-positive strains occurs, use automated systems for routine susceptibility testing, like for instance Vitek2. These systems do not cover the ESBL detection in non-fermentative Gram-negative rods. The control of the resistance mechanisms detection in 2 / 15 standard P. aeruginosa strains showed that only 12 out of 54 the Spanish laboratories performed the ESBL-detection complementary tests after routine automated susceptibility testing for PER-1 or OXA-161 producing strains, and 8 out of 54 in the case of GES-1-positive strain [ 19 ]. Consequently the correct interpretation of β-lactam resistant phenotypes of P. aeruginosa strains was obtained by only 12, 8 and 2 out of 54 laboratories in the case of strains producing PER-1, OXA-161 or GES-1 enzymes. The masking effect of the presence of AmpC on the phenotypic detection of ESBLs and the spread of MBL-positive strains are the main causes of no detection of the ESBL-producing P. aeruginosa isolates. At the same time there is no recommendation to demonstrate the possible presence of ESBL in P. aeruginosa strains. Additionally, it is considered that there is a lack of phenotypic tests allowing for rapid and easy detection of ES-OXAs. ESBL detection tests for Enterobacteriaceae are not suitable for the detection of the all ESBL-type P. aeruginosa enzymes. This is why so little is known about the prevalence of ESBL enzymes among P. aeruginosa strains compared to Enterobacteriaceae family isolates. Particularly little is known about the occurrence of such strains in Poland. To date, only one outbreak of P. aeruginosa infection with PER-1 and OXA-74 in a Warsaw hospital has been published [ 20 ]. The aim of this study was to determine the occurrence of ESBLs in P. aeruginosa clinical isolates from patients at Warsaw hospitals and to evaluate the ESBL production of these isolates using currently available phenotypic tests, their modifications, and by multiplex PCR. Moreover, the phenotypic test results were compared with the presence of particular bla genes encoding ESBL-type enzymes. Three new nucleotide sequences of ESBLs were discovered and were submitted to GenBank at NCBI. Materials and methods Bacterial isolates Nine hundred clinical isolates of P. aeruginosa obtained from 4 Warsaw hospital microbiological laboratories were examined in this study. These strains were isolated from samples of various clinical materials derived from different patients according to the principle of one isolate from one patient. The isolates were collected in the period 2000-2014 and were initially identified as ceftazidime or/and cefepime resistant P. aeruginosa strains in microbiological laboratories by routine microbial methods, including API tests (bioMeÂrieux). All strains were stored at -80ÊC until analysis. Prior to testing, each strain was subcultured twice on TSA (bioMeÂrieux) medium for 24 to 48 h at 30ÊC to ensure viability. Reagents The following antibiotic disks from Becton Dickinson were used in the study: aztreonam ATM (30 μg), cefepime FEP (30 μg), ceftazidime CAZ-10 (10 μg) and CAZ-30 (30 μg), imipenem IMP (10 μg), amoxicillin with clavulanate AMC (30/10 μg), ampicillin with sulbactam SAM (10/10 μg), piperacillin with tazobactam TZP (30/6 μg), and ceftazidime with clavulanate CAZ-CL (30/10 μg). The disks containing cefepime with clavulanate FEP-CL (30/10 μg) were purchased from BioRad. During the determination of ESBL production, two different AmpC inhibitors were used: cloxacillin (Sigma) and boronic acid (purchased as phenylboronic acid from Sigma). Determination of antibiotic susceptibility The antibiotic susceptibility of the clinical isolates against ATM, CAZ-10, and FEP was determined on Mueller-Hinton II (MH II) agar plates (Becton Dickinson) using the disc diffusion 3 / 15 method, according to the EUCAST guidelines [ 21 ]. The assay was validated by susceptibility testing of the reference strain P. aeruginosa ATCC 27853 against studied antimicrobial agents. The diameters of the growth inhibition zones were interpreted according to EUCAST guidelines [ 22 ]. Phenotypic detection of ESBL production Detection of the ESBL production by P. aeruginosa strains was performed on Mueller-Hinton II (MH II) agar plates (Becton Dickinson) with and without cloxacillin (the concentration in the medium was 250 mg/L) [ 15 ] using three disc diffusion tests: 1. Double-disc synergy test (DDST) by EUCAST [ 15 ] in three modified variants, with a disc containing different ESβL inhibitors: amoxicillin with clavulanate (DDS-AMC test), ampicillin with sulbactam (DDS-SAM test) and piperacillin with tazobactam (DDS-TZP test). In all these DDST variants, discs with ATM, CAZ-30 and FEP were used; 2. Imipenem double-disc synergy test (DDS-IPM) with discs containing CAZ-30, FEP and a disc with IPM as the ESBL inhibitor [ 18 ]; 3. Two variants of a combination disc test (CDT) that is the extended CLSI confirmatory disc diffusion test using discs with ceftazidime or cefepime alone and discs with these agents plus clavulanate (CAZ/CL test and FEP/CL test, respectively) [ 15 ]. An isolate was recognized as ESBL-positive when a difference of at least 5 mm in the inhibition zones of CAZ-CL versus CAZ-30 or FEP-CL versus FEP was obtained [ 15 ]. All DDS tests were interpreted as positive, indicating ESBL-positive strains, when clean extension of the inhibition zone of antibiotics towards the discs with AMC, SAM, TZP or IPM was observed. In the case of an isolate where there were no visible inhibition zones around the discs with β-lactams or the result was inconclusive, boronic acid (0.4 mg per disc) [ 12 ] was added to all discs with antibiotics and the DDS tests were carried out again. Genotypic detection of ESBL genes The total DNA from P. aeruginosa isolates was extracted using a commercial Genomic Mini Kit (A&A Biotechnology). The specific primers used in this study are shown in Table 1. Detection of β-lactamases was carried out in three multiplex PCR reactions: the first detected blaVEB, blaGES, blaOXA-10group and blaCTX-M2group genes and the second detected blaOXA-2group, blaSHV and blaTEM genes, while the third detected blaOXA-18, blaCTX-M-1group, blaPER, blaOXA-1group and blaBEL genes. Amplification was performed using Maxima Hot Start Taq DNA Polymerase (Thermo Scientific). A positive result in the multiplex PCR reaction was confirmed by amplification with a single primer pair. Control strains harbouring blaVEB-1, blaGES-1, blaPER-1, blaBEL-1, and blaSHV-2a (kindly provided by Prof. M.A. Toleman), blaOXA-1, blaCTX-M2 (kindly provided by Prof. M. Gniadkowski) and blaOXA-2 and blaOXA-10 (isolated in our laboratory and confirmed by sequencing) were used. Moreover, in the isolates carrying the new genes, the presence of class 1 integrons by PCR and location analysis of blaESBL genes within the variable part of integrons were determined. Sequencing and nucleotide sequence analysis DNA sequencing was performed at the Laboratory of DNA Sequencing and Oligonucleotides Synthesis, Institute of Biochemistry and Biophysics, Polish Academy of Science, Warsaw, Poland. 4 / 15 F, the forward primer for ampli®cation; R, the reverse primer for ampli®cation. a starters were slightly modi®ed. Sequence (5'-3º) CCGATTGCTTTAGCCGTTT GTTCATCGCTGTTGGGGTT CGCTTCATTCACGCACTATT TCTCTGAGGTCGCCAGGT TACAGCAGCGCCAGTGCA TCGACCCCAAGTTTCCTGT TTTTCGATGGGACGGCG TCCTACCCACCAACCCAT CCGAAGCCGTCAATGGTG CCAACCCACCATGCGACA CCATCGTCTGGTATTCGCAG CCGGTCTTGCCCTGCAC GCCTGACGATCTGGAACC GCCGTCCATCAGGCAACA GAAACTGCTGCTCTACCCG CGCCTTGCAATTCAGGTGC GCGTTATATTCGCCTGTG GCGCTCTGCTTTGTTATTC GAGTATTCAACATTTCCGTGT AATCAGTGAGGCACCTATC AAAGTGATGGCCGTGGCC ATGATGACTCAGAGCATTCGC GATATCGTTGGTGGTGCCA CCTCCCGCACGATGATC TCCACGCATCGTCAGGC TCGATGTTTGATGTTATGGAGC AGACTTGACCTGATAGTTTG Product size (bp) 350 517 710 385 571 293 642 788 757 849 For the preparation of DNA templates and sequencing, primers that generated the whole reading frame of the blaESBL gene family were used. DNA and amino acid sequence analyses were carried out using the Vector NTI AdvanceTM 11 program (Invitrogen). The obtained sequences were compared to sequences deposited in GenBank at NCBI. Pulsed-field gel electrophoresis (PFGE) All isolates producing ESBL detected by phenotype tests (ceftazidime and/or cefepime-resistant isolates) were typed by PFGE according to the Seifert et al. 2005 protocol [ 26 ] with modifications, using the SpeI enzyme (Thermo Scientific). Electrophoresis was performed by using a CHEF DR II system (BioRad). The migration conditions were as follows: switch angle 120, voltage 6 V/cm, temperature 12ÊC, and a two-blocks program with a total run time of 26 h (the first-block 1-20 s for 20 h and the second-block 15-40 s for an additional 6 h). The genomic DNA of Salmonella serotype Braenderup strain (H9812) was digested with XbaI (Thermo Scientific) [ 27 ] and the Lambda-DNA Ladder PFG Marker (New England BioLabs) were used as the DNA molecular-weight markers. PFGE patterns were analysed using GelCompar II software (Applied Maths, Belgium) with the Dice coefficient and clustering by UPGMA with 1% 5 / 15 tolerance. According to the recommendation of Tenover et al. [ 28 ], the isolates were clustered in the PFGE pulsotypes (PTs). Results Phenotypic detection of ESBL-type enzymes Among the 900 studied P. aeruginosa isolates initially described as resistant to third-generation cephalosporins, in the case of 720 isolates (80%), resistance to ceftazidime or/and cefepime was confirmed by the disc diffusion method. In 180 out of 900 (20%) isolates, the inhibition zones around the discs with cephalosporins were similar to the zone diameter breakpoints. ESBL-type enzyme production was detected in 110 out of 720 isolates (15%) in at least one of the phenotypic assays. The largest number of ESBL-positive isolates was found using the DDS-SAM test (92 out of 110 isolates) and then by using CDT with ceftazidime, DDS-AMC and DDS-IMP (77, 76 and 75 isolates, respectively). The information describing the detection of ESBL-positive P. aeruginosa isolates by different phenotypic tests in relation to the resistance profiles of the studied strains is shown in Table 2. The largest group, 79 out of 110 ESBL-positive isolates, were resistant to three antibiotics, CAZ, FEP and ATM. The second group, 21 out of 110, consisted of isolates that were resistant to CAZ and FEP and at the same time sensitive to ATM. The largest percentage of ESBL-positive strains among these two groups were detected using the DDS-SAM test, 93.7% (74 out of 79) and 71.4% (15 out of 21) isolates. Interestingly, for some of the first group of strains resistant to CAZ, FEP and ATM, it was necessary to conduct tests in the presence of boronic acid, especially in the case of DDS-AMC (31.6%, 18 out of 57 ESBL-positive isolates) and CDT with cefepime (56.3%, 18 out of 32). Generally, for the majority of ESBL-positive isolates, clean extension of the inhibition zone of ceftazidime as well as cefepime towards discs with AMC, SAM, TZP or IPM was observed. However, unlike cefepim, when using discs with ceftazidime in the extended CLSI confirmatory disc diffusion test, a large percentage of ESBL-positive isolates, 82.3% (65 out of 79) in the first group and 52.4% (11 out of 21) in the second group, was observed. DDS, double-disc synergy test with different ESBL inhibitors; AMC, amoxicillin with clavulanate; SAM, ampicillin with sulbactam; TZP, piperacillin with tazobactam; IMP, imipenem; CAZ/CL, Combination disc test with ceftazidime and clavulanate; FEP/CL, combination disc test with cefepime and clavulanate; CAZ, ceftazidime; FEP, cefepime; ATM, aztreonam; MH, Mueller-Hinton II medium; +CX, MH medium supplemented with cloxacillin (250 mg/ L); +BA, On all discs with antibiotics boronic acid (0.4 mg per disc) was added. a the number of isolates for which a positive result of ESBL-phenotypic test was obtained only when the MH medium was supplemented with cloxacillin. b the number of isolates for which a negative result of ESBL-phenotypic test was obtained on the MH medium without and with cloxacillin. When boronic acid was added to the discs with antibiotics a positive result was achieved. 6 / 15 Occurrence of bla genes encoding ESBL-type enzymes Among 110 phenotypically ESBL-positive isolates, 5 groups of bla genes encoding ESBLtype enzymes (VEB, GES, OXA-2, OXA-10 and TEM) were detected. Sequence analysis of all PCR bla genes detected in multiplex allowed the definition of the produced enzymes (Table 3). The most important observation is that four P. aeruginosa isolates carried the novel bla genes. In 2 out of these 4 isolates, a novel blaGES variant close to the blaGES-5 gene was identified and submitted as blaGES-15. The new GES-15 had one substitution, Pro167Ser, compared to GES-5, and two amino acid differences, Pro167Ser and Gly170Ser, compared to GES-1. Furthermore, the isolate carried a novel blaOXA-2 variant submitted as a blaOXA-141 gene. The new OXA-141 displayed 1 amino acid change at position 162, Gly162Ser. Additionally, sequence analysis detected a third new gene submitted as blaOXA-142 in one isolate. The new OXA-142 belongs to the OXA-10 ESBL-type family and has two substitutions in the amino acid sequence, Asn76Ser and Gly167Asp. The nucleotide sequences of the new blaGES-15, blaOXA-141 and blaOXA-142 genes were submitted to the GenBank database (accession number GU208678, EF552405 and EU358785, respectively). Moreover, all the new bla genes were located within class 1 integrons. All clinical isolates of P. aeruginosa carrying the new blaGES-15, blaOXA-141 and blaOXA-142 genes showed typical results for ESBL-positive strains in the phenotypic tests. The occurrence of all detected bla genes encoding ESBL-type enzymes with regard to the resistance profiles of P. aeruginosa isolates is presented in Table 3. Among 110 ESBL-positive isolates in phenotypic tests, the presence of bla genes encoding ESBL was shown in 99 isolates, including blaVEB-9 alone or with blaOXA-10, as well as with blaGES-13 in 69 isolates, blaGES (blaGES-1, blaGES-15) in 8, blaOXA-2-type (blaOXA-15, blaOXA-141, blaOXA-210, blaOXA-543 and blaOXA-544) in 16 and blaOXA-10-type (blaOXA-74 and blaOXA-142) in 6 isolates. Moreover, in one isolate, the blaGES-5 gene encoding carbapenemase was detected. On the other hand, the sequencing analysis showed the presence of only the blaTEM-1f gene encoding TEM-1 β-lactamase in three isolates. In the remaining seven ESBL-positive isolates, the genes encoding enzymes of the families VEB, GES, PER, OXA, TEM, SHV, BEL and CTX-M were not detected. 0 CAZ, ceftazidime; FEP, cefepime; ATM, aztreonam. a in three isolates the blaTEM-1f gene was detected. blaTEM-1f is one of gene alleles encoding TEM-1 penicillinase and is a precursor to the ESBL genes. 7 / 15 Comparison of phenotypic tests results with the presence of bla genes encoding ESBL-type enzymes In Table 4, the comparison of the results obtained from phenotypic tests and multiplex PCR detection is presented. In the case of the presence of the blaVEB-9 gene in the genomes of 69 studied isolates, the DDS-SAM test allowed for the detection of 100% of such ESBL-positive isolates. However, for one out of 10 isolates carrying only the blaVEB-9 gene, this test was positive only when the medium was supplemented with cloxacillin. Furthermore, it was necessary to use boronic acid in 3 out of 5 isolates producing additional GES-13 and OXA-10, and in 2 out of 54 isolates when only VEB-9 and OXA-10 were produced. Interestingly, the DDS-IMP test was the only phenotypic method allowing the detection of isolates producing GES-1, GES-5, OXA-74 and OXA-142, whereas the DDS-AMC test identified the strains carrying blaOXA-543. Unlike the DDS tests, the two variants of a combination disk test enabled the identification of only 78% (78 out of 100 isolates) of ESBL-producing isolates, and only 35% of CDT with cefepime (35 out of 100). Finally, the use of all three DDS tests (DDS-AMC, DDS-SAM and DDSA-IMP) allowed for phenotypic detection of 100% of studied isolates that produced ESBLs (Table 4). However, the detection of single isolates producing VEB-9, GES-1, OXA-74, OXA-543 or OXA-141 enzymes was possible due to the determination of ESBL-production by three DDS tests on the medium with cloxacillin. Carrying out these DDS tests in the presence of boronic acid, the next nine MH, Mueller-Hinton II medium; DDS, double-disc synergy test with different ESBL inhibitors; AMC, amoxicillin with clavulanate; SAM, ampicillin with sulbactam; TZP, piperacillin with tazobactam; IMP, imipenem; CAZ/CL, combination disc test with ceftazidime and clavulanate; FEP/CL, combination disc test with cefepime and clavulanate; nt, not tested because earlier for all groups of isolates positive results for tests on MH medium without cloxacilli / or on MH supplemented with cloxacillin were obtained. a in parentheses, the number of isolates for which a positive result of ESBL-phenotypic test was obtained on MH medium without cloxacillin / only on agar plates supplemented cloxacillin / only in the presence of boronic acid. The tests with the discs containing antibiotics and also boronic acid were performed only in the case of negative results on the medium without and with cloxacillin. b enzyme with carbapenemase activity. c enzymes belong to the OXA-10 family. d enzymes belong to the OXA-2 family. 8 / 15 ESBL-positive isolates (two isolates carrying blaGES-1, two other with blaVEB-9 and blaOXA-10, and also three carrying blaGES-13, blaVEB-9 and blaOXA-10) were detected. Molecular typing of ESBL-positive isolates All 110 ESBL-positive clinical isolates of P. aeruginosa as determined in phenotypic tests were genotyped by PFGE. Twenty-two different pulsotypes were obtained, from which 18 with a similarity of over 50% are presented in Fig 1. Isolates were considered as a cluster if the similarity was over 80%. The PFGE molecular typing showed the relatedness between all 69 VEB9-positive P. aeruginosa isolates obtained from different patients from one Warsaw hospital (Hospital A) during the years 2010-2014. Among these isolates belonging to PT M, two subclusters with greater than 85% similarity could be distinguished, PT Ma (isolates carried the blaVEB-9 and blaOXA-10 genes and these isolates additionally with the blaGES-13 gene) and PT Mb (carried only the blaVEB-9 gene). Discussion A wide panel of phenotypic methods applied in this study allowed for the detection of P. aeruginosa isolates producing various ESBL-type enzymes. Clinical isolates from patients from Warsaw hospitals carried genes encoding ESBL from the following families: VEB (69 isolates with VEB-9), GES (6 with GES-1, 5 GES-13 and 2 with GES-15), OXA-2 (12 with OXA-15, 1 OXA-141, 1 OXA-210, 1 OXA-543 and 1 with OXA-544) and OXA-10 (5 isolates with OXA74 and one with OXA-142). The most important achievement of this study was the discovery of three new genes, named blaGES-15, blaOXA-141 and blaOXA-142, whose nucleotide sequences have been submitted to GenBank (accession number GU208678, EF552405 and EU358785, respectively). Among P. aeruginosa strains, the OXAs were the most common and the most frequently isolated enzymes worldwide. Besides most of the ES-OXAs have been identified in P. aeruginosa strains [ 2 ]. Therefore, it is not surprising that the same ES-OXAs were found at the same time in a different part of the world. Outside Poland, the presence of OXA-142 was also detected in P. aeruginosa strains isolated in Bulgaria in 2008-2009 (3 isolates) [ 10 ] and Korea (in 4 isolates) [ 3 ]. In the case of the Polish strain, the variable part of the class 1 integron contained the gene cassette array aac(6)-Ib-blaOXA-142–aadA6/aadA10 (NCBI GenBank acc. no EU358785). Four isolates producing OXA-142 in Korea had a class 1 integron with the order of gene cassettes (aacA4- blaOXA-142–aadA2) identical to the previously submitted sequence of a plasmid-located class 1 integron from another Korean P. aeruginosa strain (NCBI GenBank acc. no KF257849). Our studies are the first to describe an OXA-141-producing bacteria. To date, in only one P. aeruginosa strain, isolated in the year 2000, the blaOXA-141 gene encoding a new ESBL enzyme was observed. Conting 67 of the whole genome shotgun sequence of P. aeruginosa strain WH-SGI-V-07247, which also contains this gene (accession no. LLTH01000109), has been recently submitted to GenBank. Our work is also the first in which two additional new ESBL-type enzymes from the OXA-2 family, OXA-543 and OXA-544, were found in P. aeruginosa clinical strains. Unfortunately, only the nucleotide sequences of contings from whole genome shotgun sequences of P. aeruginosa strains carrying these genes were submitted to GenBank, without specifying the range of activity of these new enzymes (acc. no LLTZ01000057 and LLMY01000078, respectively). Our research showed that P. aeruginosa isolates carrying these two new enzymes, OXA-543 and OXA-544, have demonstrated typical results for ESBL-positive strains in phenotypic tests. Moreover, among the studied isolates, the presence of genes encoding the OXA-15, OXA-74 and OXA-210 enzymes was demonstrated. The OXA-15 β-lactamase was identified inside a class 1 integron detected in P. aeruginosa strain from Turkey [ 29 ]. The presence of OXA-74 in the P. aeruginosa clinical 9 / 15 Fig 1. Analysis of PFGE patterns. Dendrogram presents PFGE profiles similarity, the presence of βlactamases and the origin of P. aeruginosa clinical isolates that revealed production of ESBL-type enzymes in phenotypic tests. The solid line indicates 80% similarity and was used to define PFGE type. The dotted line indicates 85% similarity and marks its division into the PT subclusters. ND, genes encoding β-lactamases from studied ESBL families were not detected by multiplex PCR. 10 / 15 isolates was described for the first time in 2007 in Poland [ 20 ], and then only in 2008 in Hungary (2 isolates) [ 30 ] and in 2013 in Bulgaria (2 isolates) [ 10 ], whereas the presence of the gene encoding OXA-210 was demonstrated so far in only one P. aeruginosa strain isolated in Korea [ 3 ]. So, this research is the second reported case of isolating an OXA-210-producing strain in another part of the worldÐPoland. An equally important observation of this study is the first report of the epidemiological problem with VEB-9-producing bacterial strains not only in Poland but also worldwide. The PFGE molecular typing showed the relatedness between all 69 VEB-9-positive P. aeruginosa isolates obtained from different patients from one Warsaw hospital during 2010-2014. Only 5 of 59 isolates grouped in the subcluster PT Ma with greater than 85% similarity also carried the blaGES-13 gene. Perhaps there has been an acquisition of the blaGES-13 gene by strains originally possessing only blaVEB-9 and blaOXA-10 genes. At first, the VEB-9 enzyme was observed in two P. aeruginosa isolates from Kuwait in 2001 [ 31 ]. To date, there are no other publications reporting the detection of VEB-9-producing strains worldwide. Recently, the whole genome shotgun sequences of three strains, P. aeruginosa AR_0092 scaffold00001 (acc. no. MPBS01000001), Acinetobacter baumannii ABBL 142 contig-1000047 (acc. no LLIK01000044) and K. pneumoniae OC511 AOT23_contig000137 (acc. no LOEI01000136), which also contain the blaVEB-9 gene, were submitted to GenBank. Among the P. aeruginosa clinical worldwide isolates, the VEB-1 enzyme was detected the most frequently [ 2,6,10,32 ]. Other important data obtained in this research include a large variety of enzymes from the GES family (GES-1, -5, -13 and GES-15) detected in P. aeruginosa isolates from such a small area as the city of Warsaw. Unlike the other detected GES-type enzymes, GES-5 possesses carbapenemase activity [ 33,34 ]. GES-1 is the most common of the ESBL-type enzymes of the GES group produced by P. aeruginosa [ 2,9 ] as well as by Enterobacteriaceae strains [ 16 ] in the world. The presence of GES-13-producing P. aeruginosa strains was described only twice, for the first time in the case of a MDR strain isolated in 2008 in Greece [ 35 ] and the second time in a P. aeruginosa strain isolated in Canada in 2012 [ 36 ]. In Polish isolates, the presence of blaGES-13 as well as blaVEB-9 and blaOXA-10 genes in the same isolate is unusual. This work is the first report of GES-15-producing bacteria in the world. The blaGES-15 gene was detected in one P. aeruginosa strain within the variable part of class 1 integron located in the plasmid. The detection of the various ESBL-type of enzymes in P. aeruginosa isolates from patients in Warsaw hospitals was possible due to the use of a wide panel of phenotypic methods. We modified and extended a double-disk synergy test, mainly by the incorporation of other clavulanic acid β-lactamase inhibitors, such as sulbactam, tazobactam and imipenem. The ESBLtype enzymes produced by P. aeruginosa strains are not always inhibited by clavulanic acid [ 5,18 ]. The most difficult was to detect the isolates harbouring the genes encoding the GEStype [ 18,36 ] or OXA-type [ 5 ] of ESBLs. As previously described, synergy between imipenem and ceftazidime was observed in the case of GES-1-producing P. aeruginosa strains in the discdiffusion method [ 18 ]. Among ES-OXAs, for example, OXA-19 can be inhibited by imipenem [ 5 ]. In addition, tazobactam was a more potent inhibitor of GES-type ESBLs (GES-1, GES-13) than other inhibitors, such as clavulanic acid, imipenem and sulbactam [ 34,35 ]. Sulbactam was only sporadically used in the CDT test to detect the ESBL-positive co-produced AmpC strains [37]. According to the EUCAST recommendations [ 15 ], for Enterobacteriaceae with inducible chromosomal AmpC, for the phenotypic detection of ESBL in this work, cefepime and the agar plates containing cloxacillin were included. It described that cefepime is less rapidly inactivated by AmpC cephalosporinases than by ESBLs [ 38 ] or even that it is stable to AmpC hydrolysis [ 15 ]. Performing the DDST on agar supplemented with cloxacillin strengthened the ability of this test to detect bacterial strains carrying genes encoding ESBLs among P. aeruginosa isolates [ 17,23,38 ]. The greatest effect improving the detection of the ESBL-positive 11 / 15 isolates in this work was the reduction in the distance between the discs in DDS tests. In the case of P. aeruginosa isolates for which the diameter zones of inhibition around the discs was not observed or was very small, the distance between the discs in DDST was reduced from 20 to 15 mm. Generally, performing conventional DDST and the above-described modifications, in 105 of the 110 ESBL-positive P. aeruginosa strains, the ability to produce these types of enzymes was observed. However, it was necessary to reduce the distance between discs with antibiotics to 15 mm in the case of 56 out of 105 ESBL-positive isolates. However, the phenotypic detection of two isolates carrying the blaGES-1 gene, two isolates carrying blaVEB-9 and blaOXA-10 genes and three isolates carrying blaGES-13, blaVEB-9 and blaOXA-10 genes required not only a reduction in the distance between discs but also the use of boronic acid. Previously, the DDST carried out with the addition of 0.4 mg of boronic acid per disc allowed the detection of BEL-1-positive P. aeruginosa strains in Belgian hospitals [ 12 ]. The data obtained in this study showed that boronic acid has a greater ability than cloxacillin to inhibit cephalosporinase overproduction. Finally, comparing the occurrence of bla genes encoding ESBLs in relation to the results obtained in this research concerning ESBL detection by phenotypic tests, it is concluded that in the case of P. aeruginosa, modified DDS tests should be used instead of tests dedicated for Enterobacteriaceae strains. Based on the data obtained in this study, we propose to use three methods (DDS-AMC, DDS-SAM and DDS-IMP) to detect ESBL-producing P. aeruginosa strains. Depending on the images of the plates, we suggest a reduction in the distance between discs with antibiotics to 15 mm and the addition of boronic acid to the discs. This study is also a good example to demonstrate the effectiveness of the proposed methods in the detection of the various ESBLs, including enzymes from the VEB, GES, OXA-2 and OXA-10 families, which allowed us to determine the occurrence of ESBLs in P. aeruginosa isolates from clinical materials from patients in Warsaw hospitals. Acknowledgments The authors are grateful to Prof. Mark A. Toleman and Prof. Marek Gniadkowski for providing some control strains harbouring blaESBL genes and thank Dr. Radek Izdebski for consultation about the PFGE data. Research were carried out with the use of CePT infrastructure financed by the European UnionÐthe European Regional Development Fund within the Operational Programme ªInnovative economy" for 2007-2013. Author Contributions Conceptualization: Agnieszka E. Laudy, Jan Patzer, Danuta Dzierżanowska, Stefan Tyski. Data curation: Agnieszka E. Laudy, Stefan Tyski. Formal analysis: Agnieszka E. Laudy. Funding acquisition: Agnieszka E. Laudy, Jan Patzer, Danuta Dzierżanowska, Bohdan Starościak, Stefan Tyski. Investigation: Agnieszka E. Laudy, Patrycja RoÂg, Katarzyna Smolińska-KroÂl, Milena C miel, Alicja Søoczyńska, Jan Patzer. Methodology: Agnieszka E. Laudy, Alicja Søoczyńska, Renata Wolinowska. Project administration: Agnieszka E. Laudy. Resources: Agnieszka E. Laudy, Patrycja RoÂg, Katarzyna Smolińska-KroÂl, Milena C miel, Jan Patzer. 12 / 15 Software: Agnieszka E. Laudy. Supervision: Agnieszka E. Laudy. Validation: Agnieszka E. Laudy, Patrycja RoÂg, Katarzyna Smolińska-KroÂl, Milena C miel, Alicja Søoczyńska. Visualization: Agnieszka E. Laudy. Writing ± original draft: Agnieszka E. Laudy, Stefan Tyski. Writing ± review & editing: Agnieszka E. Laudy, Patrycja RoÂg, Katarzyna Smolińska-KroÂl, Milena C miel, Alicja Søoczyńska, Jan Patzer, Danuta Dzierżanowska, Renata Wolinowska, Bohdan Starościak, Stefan Tyski. 13 / 15 14 / 15 1. Santajit S , Indrawattana N. Mechanisms of antimicrobial resistance in ESKAPE pathogens . Biomed Res Int . 2016 ; 2016 :2475067. https://doi.org/10.1155/ 2016 /2475067 PMID: 27274985 2. Potron A , Poirel L , Nordmann P . Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: mechanisms and epidemiology . Int J Antimicrob Agents . 2015 ; 45 : 568 ± 585 . https://doi.org/10.1016/j.ijantimicag. 2015 . 03 .001 PMID: 25857949 3. Bae IK , Suh B , Jeong SH , Wang KK , Kim YR , Yong D , et al. Molecular epidemiology of Pseudomonas aeruginosa clinical isolates from Korea producing β-lactamases with extended-spectrum activity . Diagn Microbiol Infect Dis . 2014 ; 79 : 373 ± 377 . https://doi.org/10.1016/j.diagmicrobio. 2014 . 03 .007 PMID: 24792837 4. Kos VN , McLaughlin RE , Gardner HA . Elucidation of mechanisms of ceftazidime resistance among clinical isolates of Pseudomonas aeruginosa by using genomic data . Antimicrob Agents Chemother . 2016 ; 60 : 3856 ± 3861 . https://doi.org/10.1128/AAC.03113-15 PMID: 27067331 5. Poirel L , Naas T , Nordmann P . Diversity, epidemiology, and genetics of class D β-lactamases . Antimicrob Agents Chemother . 2010 ; 54 : 24 ± 38 . https://doi.org/10.1128/AAC.01512-08 PMID: 19721065 6. Woodford N , Zhang J , Kaufmann ME , Yarde S , Tomas Mdel M , Faris C , et al. Detection of Pseudomonas aeruginosa isolates producing VEB-type extended-spectrum β-lactamases in the United Kingdom . J Antimicrob Chemother . 2008 ; 62 : 1265 ± 1268 . https://doi.org/10.1093/jac/dkn400 PMID: 18819973 7. Paterson DL , Bonomo RA . Extended-spectrum β-lactamases: a clinical update . Clin Microbiol Rev . 2005 ; 18 : 657 ± 686 . https://doi.org/10.1128/CMR.18.4. 657 - 686 . 2005 PMID: 16223952 8. Pfeifer Y , Cullik A , Witte W. Resistance to cephalosporins and carbapenems in gram-negative bacterial pathogens . Int J Med Microbiol . 2010 ; 300 : 371 ± 379 . https://doi.org/10.1016/j.ijmm. 2010 . 04 .005 PMID: 20537585 9. Garza-Ramos U , Barrios H , Reyna-Flores F , Tamayo-Legorreta E , Catalan-Najera JC , Morfin-Otero R , et al. Widespread of ESBL- and carbapenemase GES-type genes on carbapenem-resistant Pseudomonas aeruginosa clinical isolates: a multicenter study in Mexican hospitals . Diagn Microbiol Infect Dis . 2015 ; 8 : 135 ± 137 . 10. Vatcheva-Dobrevska R , Mulet X , Ivanov I , Zamorano L , Dobreva E , Velinov T , et al. Molecular epidemiology and multidrug resistance mechanisms of Pseudomonas aeruginosa isolates from Bulgarian hospitals . Microb Drug Resist . 2013 ; 19 : 355 ± 361 . https://doi.org/10.1089/mdr. 2013 .0004 PMID: 23600605 11. Poirel L , Brinas L , Verlinde A , Ide L , Nordmann P . BEL-1, a novel clavulanic acid-inhibited extendedspectrum β-lactamase, and the class 1 integron In120 in Pseudomonas aeruginosa . Antimicrob Agents Chemother . 2005 ; 49 : 3743 ± 3748 . https://doi.org/10.1128/AAC.49.9. 3743 - 3748 . 2005 PMID: 16127048 12. Glupczynski Y , Bogaerts P , Deplano A , Berhin C , Huang TD , Van Eldere J , et al. Detection and characterization of class A extended-spectrum-β-lactamase-producing Pseudomonas aeruginosa isolates in Belgian hospitals . J Antimicrob Chemother . 2010 ; 65 : 866 ± 871 . https://doi.org/10.1093/jac/dkq048 PMID: 20200037 13. Tian GB , Adams-Haduch JM , Bogdanovich T , Wang HN , Doi Y . PME -1, an extended-spectrum β-lactamase identified in Pseudomonas aeruginosa . Antimicrob Agents Chemother . 2011 ; 55 : 2710 ± 2713 . https://doi.org/10.1128/AAC.01660-10 PMID: 21402845 14. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing . 26th ed. CLSI supplement M100S . Wayne, Pennsylvania USA , 2016 . 15. The European Committee on Antimicrobial Susceptibility Testing. EUCAST guidelines for detection of resistance mechanisms and specific resistances of clinical and/or epidemiological importance . Version 1.0 , 2013 . http://www.eucast.org/resistance_mechanisms. 16. Poirel L , Bonnin RA , Nordmann P . Genetic support and diversity of acquired extended-spectrum β-lactamases in Gram-negative rods . Infect Genet Evol . 2012 ; 12 : 883 ± 893 . https://doi.org/10.1016/j. meegid. 2012 . 02 .008 PMID: 22414916 17. Jiang X , Zhang Z , Li M , Zhou D , Ruan F , Lu Y. Detection of extended-spectrum β-lactamases in clinical isolates of Pseudomonas aeruginosa . Antimicrob Agents Chemother . 2006 ; 50 : 2990 ± 2995 . https://doi. org/10.1128/AAC.01511-05 PMID: 16940093 18. Weldhagen GF , Poirel L , Nordmann P . Ambler class A extended-spectrum β-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact . Antimicrob Agents Chemother . 2003 ; 47 : 2385 ± 2392 . https://doi.org/10.1128/AAC.47.8. 2385 - 2392 . 2003 PMID: 12878494 19. Juan C , Conejo MC , Tormo N , Gimeno C , Pascual A , Oliver A . Challenges for accurate susceptibility testing, detection and interpretation of β-lactam resistance phenotypes in Pseudomonas aeruginosa: results from a Spanish multicentre study . J Antimicrob Chemother . 2013 ; 68 : 619 ± 630 . https://doi.org/ 10.1093/jac/dks439 PMID: 23143898 20. Empel J , Filczak K , MroÂwka A , Hryniewicz W , Livermore DM , Gniadkowski M. Outbreak of Pseudomonas aeruginosa infections with PER-1 extended-spectrum β-lactamase in Warsaw, Poland: further evidence for an international clonal complex . J Clin Microbiol . 2007 ; 45 : 2829 ± 2834 . https://doi.org/10. 1128/JCM.00997-07 PMID: 17634312 21. The European Committee on Antimicrobial Susceptibility Testing . EUCAST disk diffusion method for antimicrobial susceptibility testing . Version 6.0 , 2017 . http://www.eucast.org. 22. The European Committee on Antimicrobial Susceptibility Testing . Breakpoint tables for interpretation of MIC and zone diameters . Version 7.1 , 2017 . http://www.eucast.org. 23. Lin SP , Liu MF , Lin CF , Shi ZY . Phenotypic detection and polymerase chain reaction screening of extended-spectrum β-lactamases produced by Pseudomonas aeruginosa isolates . J Microbiol Immunol Infect . 2012 ; 45 : 200 ± 207 . https://doi.org/10.1016/j.jmii. 2011 . 11 .015 PMID: 22209695 24. Celenza G. , Pellegrini C. , Caccamo M. , Segatore B. , Amicosante G. , Perilli M. Spead of blaCTX-M-type and blaPER-2 genes in clinical isolates from Bolivian hospitals . J. Antimicrob. Chemother . 2006 ; 57 : 975 ± 978 . https://doi.org/10.1093/jac/dkl055 PMID: 16510850 25. Goldstein C. , Lee M.D. , Sanchez S. , Hudson C. , Phillips B. , Register B. , at. al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals and exotics . Antimicrob. Agents Chemother . 2001 ; 45 : 723 ± 726 . https://doi.org/10.1128/AAC.45.3. 723 - 726 . 2001 PMID: 11181350 26. Seifert H , Dolzani L , Bressan R , van der Reijden T, van Strijen B , Stefanik D , et al. Standardization and interlaboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii . J Clin Microbiol . 2005 ; 43 : 4328 ± 4335 . https://doi.org/10.1128/JCM.43.9. 4328 - 4335 . 2005 PMID: 16145073 27. Hunter SB , Vauterin P , Lambert-Fair MA , Van Duyne MS , Kubota K , Graves L , et al. Establishment of a universal size standard strain for use with the PulseNet standardized pulsed-field gel electrophoresis protocols: converting the national databases to the new size standard . J Clin Microbiol . 2005 ; 43 : 1045 ± 1050 . https://doi.org/10.1128/JCM.43.3. 1045 - 1050 . 2005 PMID: 15750058 28. Tenover FC , Arbeit RD , Goering RV , Mickelsen PA , Murray BE , Persing DH , et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing . J Clin Microbiol . 1995 ; 33 : 2233 ± 2239 . PMID: 7494007 29. Danel F , Hall LM , Gur D , Livermore DM . OXA-15, an extended-spectrum variant of OXA-2 β-lactamase, isolated from a Pseudomonas aeruginosa strain . Antimicrob Agents Chemother . 1997 ; 41 : 785 ± 790 . PMID: 9087490 30. Libisch B , Poirel L , Lepsanovic Z , Mirovic V , Balogh B , PaÂszti J , et al. Identification of PER-1 extendedspectrum β-lactamase producing Pseudomonas aeruginosa clinical isolates of the international clonal complex CC11 from Hungary and Serbia . FEMS Immunol Med Microbiol . 2008 ; 54 : 330 ± 338 . https:// doi.org/10.1111/j. 1574 - 695X . 2008 . 00483 . x PMID : 19049645 31. Poirel L , Rotimi VO , Mokaddas EM , Karim A , Nordmann P . VEB-1 -like extended-spectrum β-lactamases in Pseudomonas aeruginosa , Kuwait. Emerg Infect Dis . 2001 ; 7 : 468 ± 470 . https://doi.org/10. 3201/eid0703.010322 PMID: 11384532 32. Maurya AP , Talukdar AD , Chanda DD , Chakravarty A , Bhattacharjee A . Integron-borne transmission of VEB-1 extended-spectrum β-lactamase in Pseudomonas aeruginosa in a tertiary care hospital in India . Antimicrob Agents Chemother . 2014 ; 58 : 6966 ± 6969 . https://doi.org/10.1128/AAC.02365-14 PMID: 25182643 33. Bae IK , Lee YN , Jeong SH , Hong SG , Lee JH , Lee SH , et al. Genetic and biochemical characterization of GES-5, an extended-spectrum class A β-lactamase from Klebsiella pneumoniae . Diagn Microbiol Infect Dis . 2007 ; 58 : 465 ± 468 . https://doi.org/10.1016/j.diagmicrobio. 2007 . 02 .013 PMID: 17467221 34. Kotsakis SD , Miriagou V , Tzelepi E , Tzouvelekis LS . Comparative biochemical and computational study of the role of naturally occurring mutations at Ambler positions 104 and 170 in GES β-lactamases . Antimicrob Agents Chemother . 2010 ; 54 : 4864 ± 4871 . https://doi.org/10.1128/AAC.00771-10 PMID: 20696873 35. Kotsakis SD , Papagiannitsis CC , Tzelepi E , Legakis NJ , Miriagou V , Tzouvelekis LS . GES- 13 , a β-lactamase variant possessing Lys-104 and Asn-170 in Pseudomonas aeruginosa . Antimicrob Agents Chemother . 2010 ; 54 : 1331 ± 1333 . https://doi.org/10.1128/AAC.01561-09 PMID: 20065056 36. Sepehri S , Poliquin G , Alfattoh N , Boyd D , Mulvey M , Denisuik A , et al. Osteomyelitis due to multiple carbapenemase-producing Gram-negative bacteria: The first case report of a GES-13-producing Pseudomonas aeruginosa isolate in Canada . Can J Infect Dis Med Microbiol . 2014 ; 25 : 229 ± 231 . PMID: 25285131 37. Singla P , Sikka R , Deeep A , Gagneja D , Chaudhary U. Co-production of ESBL and AmpC β-lactamases in clinical isolates of A. baumannii and A. lwoffii in a tertiary care hospital from northern India . J Clin Diagn Res . 2014 ; 8: DC16±DC19. 38. Drieux L , Brossier F , Sougakoff W , Jarlier V . Phenotypic detection of extended-spectrum β-lactamase production in Enterobacteriaceae: review and bench guide . Clin Microbiol Infect . 2008 ; 14 Suppl 1 : 90 ± 103 .


This is a preview of a remote PDF: http://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0180121&type=printable

Agnieszka E. Laudy, Patrycja Róg, Katarzyna Smolińska-Król, Milena Ćmiel, Alicja Słoczyńska, Jan Patzer, Danuta Dzierżanowska, Renata Wolinowska, Bohdan Starościak, Stefan Tyski. Prevalence of ESBL-producing Pseudomonas aeruginosa isolates in Warsaw, Poland, detected by various phenotypic and genotypic methods, PLOS ONE, 2017, DOI: 10.1371/journal.pone.0180121