Sex- and brain region-specific patterns of gene expression associated with socially-mediated puberty in a eusocial mammal

PLOS ONE, Feb 2018

The social environment can alter pubertal timing through neuroendocrine mechanisms that are not fully understood; it is thought that stress hormones (e.g., glucocorticoids or corticotropin-releasing hormone) influence the hypothalamic-pituitary-gonadal axis to inhibit puberty. Here, we use the eusocial naked mole-rat, a unique species in which social interactions in a colony (i.e. dominance of a breeding female) suppress puberty in subordinate animals. Removing subordinate naked mole-rats from this social context initiates puberty, allowing for experimental control of pubertal timing. The present study quantified gene expression for reproduction- and stress-relevant genes acting upstream of gonadotropin-releasing hormone in brain regions with reproductive and social functions in pre-pubertal, post-pubertal, and opposite sex-paired animals (which are in various stages of pubertal transition). Results indicate sex differences in patterns of neural gene expression. Known functions of genes in brain suggest stress as a key contributing factor in regulating male pubertal delay. Network analysis implicates neurokinin B (Tac3) in the arcuate nucleus of the hypothalamus as a key node in this pathway. Results also suggest an unappreciated role for the nucleus accumbens in regulating puberty.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

http://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0193417&type=printable

Sex- and brain region-specific patterns of gene expression associated with socially-mediated puberty in a eusocial mammal

February Sex- and brain region-specific patterns of gene expression associated with socially- mediated puberty in a eusocial mammal Mariela Faykoo-Martinez 0 1 D. Ashley Monks 0 1 Iva B. Zovkic 0 1 Melissa M. Holmes 0 1 0 Department of Cell & Systems Biology, University of Toronto , Toronto, ON , Canada , 2 Department of Psychology, University of Toronto Mississauga , Mississauga, ON , Canada , 3 Department of Ecology and Evolutionary Biology, University of Toronto , Toronto, ON , Canada 1 Editor: Juan M. Dominguez, University of Texas at Austin , UNITED STATES The social environment can alter pubertal timing through neuroendocrine mechanisms that are not fully understood; it is thought that stress hormones (e.g., glucocorticoids or corticotropin-releasing hormone) influence the hypothalamic-pituitary-gonadal axis to inhibit puberty. Here, we use the eusocial naked mole-rat, a unique species in which social interactions in a colony (i.e. dominance of a breeding female) suppress puberty in subordinate animals. Removing subordinate naked mole-rats from this social context initiates puberty, allowing for experimental control of pubertal timing. The present study quantified gene expression for reproduction- and stress-relevant genes acting upstream of gonadotropinreleasing hormone in brain regions with reproductive and social functions in pre-pubertal, post-pubertal, and opposite sex-paired animals (which are in various stages of pubertal transition). Results indicate sex differences in patterns of neural gene expression. Known functions of genes in brain suggest stress as a key contributing factor in regulating male pubertal delay. Network analysis implicates neurokinin B (Tac3) in the arcuate nucleus of the hypothalamus as a key node in this pathway. Results also suggest an unappreciated role for the nucleus accumbens in regulating puberty. - Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: This work was funded by a NSERC Discovery Grant (402633) and Ontario Early Researcher Award to MMH, a NSERC Discovery Grant (312458) to DAM, a NSERC Accelerator Grant (498391) to IBZ and a NSERC (http://nserccrsng.gc.ca) USRA and CGS M to MFM. The funders had no role in study design, data collection Introduction The biological process of puberty marks the onset of reproductive maturity, and is characterized by striking morphological, physiological and neurobiological changes. The timing of pubertal onset varies within and between sexes of diverse species [1±8], having implications for reproductive fitness [9±10]. Variation in pubertal timing also affects health in humans. Data from the past century indicate that puberty is occurring at a younger age [9, 11±12], with early puberty onset linked to increased incidence of negative health outcomes in adolescence (e.g. depression [13]) and adulthood (e.g. breast cancer [14±16]). While mechanisms underlying individual differences in pubertal timing are not yet fully understood, it is known that environmental factors, particularly social cues and interactions, contribute to population variability in timing within a species. For example, in female rhesus macaques (Macaca mulatta), and analysis, decision to publish, or preparation of the manuscript. peer aggression delays pubertal timing [17], while housing female laboratory guinea pigs (Cavia aperea) [18] or mice (Mus musculus) [19] with an adult male causes a shift to earlier puberty onset. In humans, environmental changes associated with wartime have been linked with delayed puberty in females [20±21], while other stressors result in an earlier onset in both sexes [22±25]. Puberty is initiated by activation of the hypothalamic-pituitary-gonadal (HPG) axis. At the onset of puberty, a small neuronal population in the pre-optic area releases gonadotropinreleasing hormone (GnRH) [26±28], causing the pituitary gland to release luteinizing and follicle stimulating hormone, ultimately triggering steroid hormone production by the gonads. The GnRH neurons are themselves regulated by a subpopulation of kisspeptin-neurokinin Bdynorphin (KNDy) neurons in the arcuate nucleus that act in feedback control of GnRH secretion in sheep (Ovies aries) [29±30] and rats (Rattus norvegicus) [31]. KNDy neurons have been directly implicated in influencing fertility and puberty; for example, loss-of-function mutations of neurokinin B ligand and receptor (Tac3 and Tac3r) result in infertility in humans [32], rodents [33±34], and teleosts [35]. Kisspeptin (Kiss1) acts as a stimulatory player in this network, stimulating release of GnRH via projections to GnRH neurons in the pre-optic area and median eminence [30, 36]. Consequently, antagonists of the kisspeptin receptor (Kiss1r) significantly reduce the luteinizing hormone (LH) surge characteristic of the pre-ovulatory phase [37±38]. Conversely, dynorphin inhibits pulsatile GnRH secretion [39] while neurokinin B can both stimulate and inhibit GnRH secretion depending on coincident endocrine signalling [40±41]. GnRH release is also inhibited by RFamide-related peptide-3 (RFRP-3; mammalian ortholog to gonadotrophin inhibitory hormone, GnIH), which might serve as an additional neuroendocrine signal controlling the onset of puberty [42±44]. Glucocorticoids modulate life history transitions (e.g., dispersal) across vertebrates [45] and are a key mechanism via which environmental cues can alter pubertal neuroendocrine signaling. The hypothalamic-pituitary-adrenal (HPA) axis is activated by stressors, with neurons in the paraventricular nucleus of the hypothalamus releasing corticotropin-releasing hormone, causing the pituitary gland to secrete adrenocorticotropic hormone, which in turns stimulates glucocorticoid release from the adrenal cortex. These circulating glucocorticoids then interact with the hippocampus, paraventricular nucleus and the pituitary gland through negative feedback. Administration of the synthetic glucocorticoid dexamethasone to fetal [46] or pre-pubertal [47] female rats delays pubertal onset as measured by vaginal opening. Chronic administration of corticotropin-releasing hormone also delays puberty in female rats [48]. While glucocorticoid exposure in utero can influence GnRH neuron morphology and function [49±51], the effects of stress on pubertal timing may be, at least in part, due to postnatal alterations in KNDy neuron signaling [52]. Pre-pubertal dexamethasone reduces Kiss1r mRNA in female rat hypothalamus [47] and corticosterone decreases activation of Kiss1 neurons, ultimately suppressing LH surges, in post-pubertal female mice [53]. The KNDy neuron ligandreceptor pair Tac3/Tac3r is required for stress effects on LH pulse frequency: antagonism of Tac3r blocks lipopolysaccharide-induced delays in the LH pulses of adult female rats [54]. Not only does stress influence pubertal timing but pubertal status (i.e. pre-, peri- or post-pubertal) itself affects HPA axis responsiveness to social stressors [55±62], making the interactions between stress and reproductive neuroendocrinology crucial for understanding how the social environment mediates puberty onset. Naked mole-rats (Heterocephalus glaber) are eusocial rodents that undergo socially-mediated pubertal suppression [63]. This pre-pubertal state persists indefinitely throughout their adult life unless they are released from social suppression, making it a unique phenomenon amongst mammals and allowing for experimental control over the initiation of puberty. Naked mole-rats live in large colonies of up to 300 individuals in which reproduction is 2 / 25 restricted to a single breeding female and 1±3 male breeders [64±65]. All other animals are non-reproductive subordinates (i.e., pre-pubertal), who, if removed from the suppressive cues of the breeding female, will undergo endocrine and behavioral transitions characteristic of mammalian puberty [66±68]. There is plasticity in brain and body morphology associated with the transition, including the emergence of sex differences that are not present prior to puberty [69±72]. Interestingly, reproductive suppression is more rigid in females than in males [65, 73] suggesting potential sex differences in mechanisms underlying pubertal suppression. Although timing of puberty differs between naked mole-rats and common laboratory species studied in puberty research like rats or mice, the key components of the pubertal transition (i.e. HPG axis activation) are conserved [70, 74±75]. Prior to puberty, subordinate naked mole-rats have low progesterone, testosterone and LH concentrations; progesterone and testosterone can increase within a week of colony separation, with sexual behavior and sex-typical distribution of steroid hormone receptors in sociosexual neural circuits following soon thereafter [65, 70, 73]. While GnRH cell number does not vary with sex or status, female breeders have more kisspeptin immunoreactive cells in the rostral periventricular region of the third ventricle and anterior periventricular hypothalamic nuclei relative to female subordinates and male breeders [74]. Subordinate naked mole-rats of both sexes have higher RFRP-3 expression than do breeders in the arcuate and paraventricular hypothalamic nuclei (with extensive fibre distribution), while exogenous RFRP-3 suppresses pubertal onset in animals removed from the suppressive cues of the colony [75]. The sex-by-status differences in hypothalamic kisspeptin, but not RFRP-3, suggests sex-specific regulation of reproduction by KNDy neurons; no research has been reported on neurokinin B and dynorphin A in naked mole-rats. To identify candidate genes and circuits involved in socially-mediated pubertal suppression in naked mole-rats, we quantified expression of several reproduction- and stress-relevant genes that act upstream of GnRH (outlined in Fig 1). We compared subordinate and breeding animals, in addition to a transition group of reproductively-activated, non-breeding animals (opposite-sex paired; OS; described in [76]) (Fig 1A). OS animals are removed from the suppressive cues of the colony, but while they show evidence of reproductive maturation, they have yet to produce a litter. Their role in this design served to tease apart social suppression from actual reproduction. Specific brain regions were selected for their importance to reproduction and stress (Fig 1B, Fig 2). We also measured circulating cortisol, testosterone and progesterone to measure how stress and reproductive status are associated with gene expression levels in the brain. We hypothesized that gene expression varies in a brain region- and sex-specific manner to co-ordinate the neuroendocrine signalling required for reproductive suppression and subsequent maturation. We predicted genes imperative to maintaining pubertal suppression would be elevated in relevant regions in subordinates, but not in OS or breeding animals. Furthermore, we predicted sex differences in gene expression in subordinate animals due to the higher degree of reproductive suppression evident in subordinate females of this species. Methods Animals and housing A total of 44 naked mole-rats from three sex-balanced groups were used: colony-housed breeders (N = 14), colony-housed subordinates (N = 14) and opposite-sex pair-housed subordinates (OS, N = 16). Breeding pairs and sex-matched subordinate animals were taken from 7 colonies, while paired animals were taken from 9 colonies. OS animals were unfamiliar conspecifics, one animal of each sex, paired together in a new cage for 4 weeks. Animals were agematched across colonies and fell within the following age and weight ranges: subordinates (N = 7 per sex) were 1±9.5 years old and weighed 27±59 g, OS animals (N = 8 per sex) were 3 / 25 Fig 1. Experimental design and workflow. A) Naked mole-rats live in large colonies with strict reproductive hierarchies. The only reproductively-active animals are the breeding female and 1±3 breeding males; all other animals are reproductively-inactive, pre-pubertal subordinates regardless of age. An animal removed from the suppressive cues of the colony can be paired with an unfamiliar conspecific to trigger pubertal onset. In this study, we collected breeders (N = 14) and subordinates (N = 14) of both sexes from in-colony, in addition to animals that had been paired with an opposite sex animal for four weeks (N = 16). B) 7 brain regions (NAcc = nucleus accumbens, lavender; POA = pre-optic area, green; DHipp = dorsal hippocampus, purple; MeA = medial amygdala, turquoise; PVN = paraventricular nucleus/dorsomedial nucleus; pink; Arc = arcuate nucleus/median eminence, blue; VHipp = ventral hippocampus, orange) and gonads were collected from all animals, followed by RNA extraction and cDNA synthesis. Quantitative PCR was then used to determine relative gene expression, with the brain regions in which a gene was quantified indicated by a square of the same colour (i.e. a gene with a lavender box means it was quantified in the NAcc). Data were normalized to Gapdh and analyzed in three ways: sex-specific hierarchically clustered heatmaps (Fig 3), sex-specific correlation networks (Fig 4), and sex-by-group ANOVAs for individual gene analysis (Figs 5 and 6). PLOS ONE | https://doi.org/10.1371/journal.pone.0193417 4 / 25 0.75±3.5 years old and weighed 32±57 g, and breeders (N = 7 per sex) were 3.5±8 years old and weighed 31±74 g. All colonies were housed in polycarbonate cages of three sizes (large: 65 cm L x 45 cm W x 23 cm H; medium: 46 cm L x 24 cm W x 15 cm H; small: 30 cm L x 18 cm W x 13 cm H) connected by tubes (25 cm L x 18 cm D) and lined with corn cob bedding. Opposite-sex pairs were housed in a single, medium polycarbonate cage. Naked mole-rats were kept on a 12:12 light/dark cycle at 28±30ÊC and fed ad libitum with a diet consisting of sweet potato and wet 19% protein mash (Harlan Laboratories Inc.). All experimental procedures followed federal and institutional guidelines and were approved by the University Animal Care Committee. Tissue collection Animals were removed from colony (breeders and subordinates) or pair housing (OS) and immediately anaesthetized in an isoflurane chamber. They were then quickly weighed and decapitated, and trunk blood was collected. All animals were decapitated within 5 minutes of handling the cage. Blood samples were kept on wet ice until centrifugation, and serum stored at -20ÊC. Brains and gonads were extracted from animals, frozen in liquid nitrogen and stored at -80ÊC until sub-dissections. At a later date, brains were sliced at 2-mm intervals in a mouse brain matrix on dry ice in a sterile environment. An Integra Miltex biopsy punch (Cat. No. 3331AA-P/25) was used to extract four tissue punches (1-mm diameter; bilateral; 2 per hemisphere) from each of the following brain regions: pre-optic area; nucleus accumbens; medial amygdala; paraventricular/dorsomedial nuclei of the hypothalamus; dorsal hippocampus; ventral hippocampus; and arcuate nucleus/median eminence (Figs 1 and 2). Both sides of the Fig 2. Schematic of representative sections sliced at 2-mm using the brain matrix. A biopsy punch (1-mm diameter) was used to take 4 punches bilaterally (i.e. 2 punches on left, 2 punches on right) in each of the 7 regions depicted. 5 / 25 sectioned tissue were checked while punching to assess for regional overlap. Dissected regions were then stored at -80ÊC in sterile tubes until RNA extraction. Sample preparation and quantitative Polymerase Chain Reaction (qPCR) RNA was extracted from all samples (brain regions and gonads) using a BioBasic kit (Cat. No. BS82322) and treated with DNase I (Qiagen, Cat. No. 79254). Sample concentration and quality was determined using a Nanodrop 1000 spectrophotometer. cDNA was then synthesized using ThermoFisher Scientific reverse transcriptase (Cat. No. 4368814) and diluted 1:5 to 2 ng/μL. A summary of genes selected and their function can be found in Table 1. Species-specific primer sequences used for performing qPCR were optimized through a standard dilution and melt curve, listed in Table 2. qPCR was run using ABM Evagreen master mix (Cat. No. MasterMix-R) on a BioRad CFX ConnectTM (Cat. No. 1855201) with a 10 min incubation at 95ÊC followed by 40 cycles (15 seconds denature, 60 seconds annealing). Each 10 μL reaction contained 2 μL of cDNA and was run in triplicate. 3% dimethyl sulfoxide was added to the reaction mixture for Kiss1 due to high G/C content and number of repeats in the primer sequence. For each gene, individual animals and brain regions were distributed randomly across different plates with subordinate animals acting as baseline for relative gene expression calculations. For each experimental gene, the triplicate was averaged, normalized first to the Gapdh Ct in the same brain region for that individual and then to the average of the control group, subordinates of both sexes (delta delta Ct). Hormone assays Progesterone was measured using an enzyme-linked immunosorbent assay (ELISA) kit from Cayman Chemical (Cat. No. 582601) with serum diluted 1:10 in buffer. The assay is sensitive Function Receptor for corticotropin-releasing hormone, a major regulator of the hypothalamic-pituitary-adrenal axis Receptor for corticotropin-releasing hormone, a major regulator of the hypothalamic-pituitary-adrenal axis Receptor for RFamide related peptide 3 (i.e. ligand produced from Npvf following post-translational modifications) Receptor for dynorphin A (i.e. ligand produced from Pdyn following post-translational modifications) Initiates gonadotropin releasing hormone (GnRH) secretion at puberty and ovulation; co-localizes with dynorphin A and neurokinin B in KNDy neurons for feedback regulation of GnRH neurons Receptor for kisspeptin Precursor for RFamide-related peptide-3, which inhibits GnRH Receptor for glucocorticoid, involved in negative feedback regulation of hypothalamic-pituitary-adrenal axis Precursor for dynorphin A; co-localizes with kisspeptin and neurokinin B in KNDy neurons for feedback regulation of GnRH neurons Initiates GnRH secretion at puberty and ovulation; co-localizes with kisspeptin and dynorphin A in KNDy neurons for feedback regulation of GnRH neurons Receptor for neurokinin B 6 / 25 Reverse Sequence AGATCTCAGGGGCTGCTTTG GCAGTAGGAGTAGGGACCTGAG ACGCTGGGATGATGTTCTG GCAGGGTTAGCTTCTCTCGG GTGATCCTGCGGAGGTTTCG GATTCTCCACAGGTGCCACCTT CCGCCAGGTTAGCGATATAGA CCCGAATCTCAGTGGCAAGT TGCTGTCTACCTTCCACTGC CGTAGCGTTTGACCTGCTCC AGGTGTGTCTGGAAGGCTGT TGGGGTTGTACATGGTCGAG to a minimum of 10 pg/mL with an intra-assay coefficient of variation of less than 12%. There is a manufacturer reported assay cross-reactivity with 17β-estradiol (7.2%), 5β-pregnan-3α-ol20-one (6.7%), pregnenolone (2.5%), and less than 0.5% with any other hormone or metabolite. Total testosterone was measured using an ELISA kit from Enzo Life Sciences (Cat. No. ADI-901-065) with serum diluted 1:5 in buffer. The assay is sensitive to a minimum of 5.67 pg/mL with an intra-assay coefficient of variation of 10%. There is a manufacturer reported assay cross-reactivity with 19-hydroxytestosterone (14.6%), androstenedione (7.20%) and less than 1% of other hormones and metabolites. Cortisol was measured using an ELISA kit from Cayman Chemical (Cat. No. 500360) with serum diluted 1:10 in buffer. The assay is sensitive to a minimum of 80 pg/mL with an intraassay coefficient of variation of less than 14%. There is a manufacturer reported assay crossreactivity with dexamethasone (15%), prednisolone (4%), cortexolone (1.6%), and less than 1.0% with any other hormone or metabolite. A Synergy-HT-Bio-Tek plate reader was used to measure the ELISA plate absorbance at 405 nm for testosterone, progesterone and cortisol. All samples were run in duplicate and the average reported. All protocols were followed as per manufacturer specifications. Statistical analyses All statistical analyses were performed based on the relative enrichment determined for each sample. Enrichment was relative to all subordinates (males and females combined) allowing us to statistically examine sex differences. If enrichment was calculated in a sex-stratified manner (i.e., relative to same sex subordinates), we would not be able to statistically compare expression in males and females. The relative enrichment was calculated as 2-x, where x is delta delta Ct. Major outliers were removed prior to analysis, defined as 2 standard deviations above or below the mean of its group and sex. While we attempted to balance colony of origin across experimental groups, we were not always able to do so for the OS group. Thus, animals were statistically treated as independent individuals, regardless of colony origin or pairing as in the case of OS animals. Given the exploratory nature of this study, where our goal was to identify candidate genes and circuits involved in socially-mediated pubertal suppression, we employed a liberal statistical approach. 7 / 25 Fig 3. Sex- and status-specific heatmaps. Heatmap of gene expression means for a group in a given brain region, arranged using hierarchical clustering separated by sex (females on left, males on right). Groups are ordered to represent temporal progression through puberty, with SUB (reproductively inactive, socially subordinate) on the left, OS (reproductively active, removed from colony hierarchy) in the middle and BRE (reproductively active, socially dominant) on the right, to visualize how a gene's expression pattern changes across the transition. Means were adjusted to z-scores with blue indicating low relative expression and red indicating high relative expression. BRE = breeder, SUB = subordinate, OS = opposite sex paired. First, because neuroendocrine signaling is sexually differentiated in other mammals, gene expression means for each sex were separated by group and plotted on a heatmap to observe sex-specific gene expression patterns between the reproductive groups (Fig 3). The heatmaps were produced in R using the gplots package for plotting, while the stats package was used to produce a hierarchical clustering of genes that associated by similarity in gene expression pattern across the three groups [77]. A scale was used to transform means into z-score values to account for the distribution of values. Second, to further explore the clustering of genes as presented by the hierarchical clustering in the heatmaps, sex-specific regional cluster networks were produced (Fig 4). The Hmisc package in R was used to create network edges based on the pair-wise Pearson correlations of all females and all males, with a liberal threshold placed at p<0.05 [78]. Edge data was imported into Cytoscape and genes clustered based on brain region [79]. The Network Analyzer plug-in was used to adjust edge-weight based on correlation strength and node size based on within-network degree (i.e. number of edges for a given node) [80]. Positive correlations were assigned a grey line and negative correlations assigned a red line. Finally, group-by-sex ANOVAs were used to analyze data for relative gene expression in each region, as well as for age, weight, and circulating hormone levels, using the psych package in R, followed by Tukey's HSD [81]. Results with a p<0.05 were considered statistically significant. ANOVAs were plotted using the ggplot2 package in R (Figs 5±7) [82]. 8 / 25 Fig 4. Correlation networks for females (left) and males (right). Pair-wise Pearson's correlations were calculated for relative expression data with a threshold placed at p<0.05 and r>0.4. Genes were clustered and color-coordinated based on brain region. Edge-weight value is visualized through edge thickness (directly correlated to magnitude of the correlation value, r) while node size is a measure of degree (how many edges are connected to a given node). Grey lines denote positive correlations and red lines denote negative correlations. The miscellaneous group encompasses measurements that are not gene expression (hormone data, age, weight) but interact with these data. A description of mapped genes (Nr3c1, Crhr1, Crhr2, Npvf, Gpr147, Kiss1, Kiss1r, Tac3, Tac3r, Pdyn and Kor) can be found in Table 1. NAcc = nucleus accumbens, POA = pre-optic area, Amyg = amygdala, PVN = paraventricular/dorsomedial nuclei, Arc = arcuate nucleus/median eminence, DHipp = dorsal hippocampus, VHipp = ventral hippocampus. Results Body weight varied by sex and group; age varied by group Breeders were significantly older than other groups (main effect of group: F( 2,38 ) = 35.0; p<0.0001) though no significant effect of sex (F( 1,38 ) = 0.256; p = 0.616) or interaction (F( 2,38 ) = 0.012; p = 0.988) was detected. A significant main effect of sex (F( 1,38 ) = 8.24; p = 0.007) and group (F( 2,38 ) = 3.83; p = 0.031) was revealed for weight, where females and breeders were heavier, respectively. No significant sex-by-group interaction on weight was detected (F( 2,38 ) = 1.33, p = 0.275). Heatmaps and networks reveal sex-specific patterns in gene expression The heatmaps present a time lapse, using a cross-sectional design, of how gene expression changes from subordinate to OS to breeder in each brain region. In contrast, the networks reveal sex-specific patterns of inter- and intra-regional correlations for gene expression. The heatmaps (Fig 3) and networks (Fig 4) were analyzed visually in parallel to identify patterns; underlying statistical analyses for Figs 3 and 4 use orthogonal methodology. Expected patterns emerge in both female visuals: positive correlations between age, weight, and progesterone. This pattern is expected as female breeders are older, heavier and have significantly higher progesterone (see ANOVA results below) [64, 74, 83]. Several patterns of relative gene expression are observed in both sexes. First, Nr3c1, Kiss1r, Tac3 and Tac3r form a sub-network in the paraventricular/dorsomedial nuclei. Second, Kiss1, Pdyn and Kor are all highly correlated in the arcuate nucleus. Finally, in both sexes, but more so in females, Npvf and Nr3c1 are highly correlated in the gonads; this could be a subordinatedriven effect given that Nr3c1 could be acting to repress reproduction by increasing Npvf. In contrast, notable sex differences were detected when comparing the relative degree (i.e., 9 / 25 number of edges corresponding to the node) of network nodes. The nodes with the highest degree in females are Tac3, Gpr147 and Nr3c1 in the arcuate nucleus, Crhr1 in the nucleus accumbens and ventral hippocampus, and Nr3c1 in the pre-optic area. Furthermore, females have increased intraregional correlations in the arcuate nucleus and increased interregional correlations between the pre-optic area to arcuate nucleus and the paraventricular nucleus to nucleus accumbens. For males, the nodes with the highest degree are Tac3, Tac3r, Crhr2 and Kor in the arcuate nucleus, Crhr1 in the medial amygdala and Kiss1r in the paraventricular nucleus. Males have several other sex-specific gene expression patterns: 1) Crhr1 in the paraventricular nucleus is highly correlated to Npvf in the gonads; 2) Tac3, Tac3r and Crhr1 are highly correlated to one another in the arcuate nucleus; 3) Gpr147 in the pre-optic area is correlated to Npvf in the paraventricular nucleus; 4) Nr3c1, Tac3, Tac3r, Kiss1, Kiss1r and Pdyn are all upregulated in a positive correlation network in the pre-optic area; and 5) Nr3c1 in the gonads is also correlated to several genes in the paraventricular nucleus and the arcuate nucleus. Individual gene analysis reveals sex- and/or group-differences in gene expression Only results that are statistically significant (p<0.05), or statistical trends (p<0.10), are reported here; all other ANOVA results can be found in Supplementary Table 1. Expression of genes was influenced by sex in the nucleus accumbens and paraventricular nucleus. Males, regardless of group, had higher expression of Tac3r in the nucleus accumbens (main effect of sex: F( 1,37 ) = 4.10, p = 0.05) (Fig 5A), while the main effect of sex on Kiss1 in this region approached significance (F( 1,36 ) = 4.04, p = 0.052) (Fig 5B). Also in the nucleus accumbens, males had higher expression of Npvf (main effect of sex: F( 1,36 ) = 4.96, p = 0.032) (Fig 5C). A significant sex-by-group interaction for Gpr147 in the nucleus accumbens (F( 2,34 ) = 3.37, p = 0.046) was detected; post-hoc tests were not significant though subordinate males trend towards higher expression than subordinate females (p = 0.100). Similarly, males had higher expression of Gpr147 in the paraventricular nucleus (F( 1,32 ) = 4.24, p = 0.048) (Fig 5D). A significant sex-by-group interaction was found for Tac3r in this region (F( 2,37 ) = 5.99, p = 0.005) (Fig 5E). Post-hoc analyses only approached significance with breeding males having higher expression than breeding females (p = 0.083), subordinate males (p = 0.095) and OS males (p = 0.095). Kor in the paraventricular nucleus approached statistical significance where females trended towards higher expression (F( 1,33 ) = 4.00, p = 0.054) (Fig 5F). Expression of stress-related genes varied according to sex and/or group, depending on brain region. Crhr2 in the nucleus accumbens was highest in OS animals (main effect of group: F( 2,36 ) = 3.68, p = 0.035) (Fig 6A) whereas Crhr2 in the arcuate nucleus (main effect of group: F = ( 2,34 ) = 3.54, p = 0.040) was higher in subordinates relative to breeders (Fig 6B) and higher relative to all groups in the medial amygdala (F( 2,36 ) = 4.20, p = 0.023) (Fig 6C). For the paraventricular nucleus, a significant sex-by-group interaction (F( 2,37 ) = 3.45, p = 0.042) and main effect of group (F( 2,37 ) = 3.97, p = 0.027) (Fig 6D) for Crhr2 reveals breeding males had higher expression than subordinate males (p = 0.027) and subordinate females (p = 0.017), and trended towards higher expression than breeding females (p = 0.063), while subordinates had lower expression overall. A main effect of group was found for the glucocorticoid receptor gene, Nr3c1, expression in the dorsal hippocampus (F( 2,37 ) = 4.02, p = 0.026) (Fig 6E) where subordinate animals had higher expression than OS animals. Finally, Nr3c1 expression also varied according to sex and group in the paraventricular nucleus (F = ( 2,35 ) = 7.18, p = 0.002) where OS females had higher expression than breeding females (p = 0.023) and subordinate males (p = 0.033), and trended towards higher expression in OS males (p = 0.062) and subordinate females (p = 0.067) (Fig 6F). 10 / 25 Fig 5. Relative mRNA expression in the NAcc and PVN +/- standard error of the mean. A) Tac3r, NAcc: Males had elevated expression as compared to females, p = 0.050. B) Kiss1, NAcc: The main effect of sex, favoring males, approached significance, p = 0.052. C) Npvf, NAcc: Males had elevated expression as compared to females, p = 0.032. D) Gpr147, NAcc: A significant sex-by-group interaction (p = 0.046) was detected. E) Gpr147, PVN: Males had elevated expression as compared to females: p = 0.048. F) Tac3r, PVN: A significant sex-by-group interaction (p = 0.005) was detected. G) Kor, PVN: The main effect of sex, favoring males, approached significance, p = 0.054. No statistically significant post hoc comparisons were detected following the significant main or interaction effects. NAcc = nucleus accumbens, PVN = paraventricular/dorsomedial nucleus, BRE = breeder, SUB = subordinate, OS = opposite sex paired. Circulating steroids varied by sex and/ or group Significant main effects of sex (F( 1,38 ) = 12.2, p = 0.001) and group (F( 2,38 ) = 14.0, p<0.0001) were observed for circulating progesterone with females and breeders having higher levels, respectively (Fig 7A). A significant group-by-sex interaction effect (F( 2,38 ) = 15.5, p<0.0001) indicated that both significant main effects were driven by breeding females having greatly elevated progesterone (p<0.001 compared to all other groups). A group-by-sex ANOVA on circulating testosterone revealed a significant main effect of sex (F( 1,38 ) = 7.30, p = 0.01), with males having higher testosterone than females (Fig 7B). A significant main effect of group revealed (F( 2,38 ) = 7.80, p = 0.001) that breeders and OS animals had greater total testosterone than subordinates, reflecting reproductive maturation in these groups. The group-by-sex interaction did not reach statistical significance (F( 2,38 ) = 1.19, p = 0.31). Overall, males had significantly higher circulating cortisol (main effect of sex: F( 1,38 ) = 4.81, p = 0.048) compared to females (Fig 7C). The main effect of group approached significance (F( 2,38 ) = 2.88, p = 0.066) with OS animals having higher cortisol, while the group-bysex interaction was non-significant (F( 2,38 ) = 1.07, p = 0.230). Discussion Utilizing expression studies of genes acting upstream of GnRH in several brain regions, we identify neuroendocrine candidates involved in the socially-mediated pubertal suppression seen in naked mole-rats. We employed a liberal, exploratory approach to generate a large amount of data which can serve as the foundation for future directed hypothesis testing. In addition to revealing an under-appreciated association of the nucleus accumbens with this reproductive transition, we identify sex-specific gene expression patterns associated with pubertal transition in a species with reduced sex differences in the brain and behavior [69±70, 74±76, 84±89]. For example, while we have identified neurokinin B (Tac3) in the arcuate nucleus as a key node in both males and females, a sub-network of Tac3/Tac3r/Crhr1 signalling in the arcuate nucleus seems to be exclusive to males, suggesting sex-specific mechanisms for crosstalk between the HPA and HPG axes. Sex differences in gene expression are associated with pubertal suppression The onset of puberty in naked mole-rats manifests in sex-specific ways, as in other mammals. Here, we report that in OS and breeding animals, males had increased circulating testosterone, while female breeders had higher progesterone relative to all other groups [consistent with 56, 62, 65, 68]. Gene expression patterns also differed between sexes, with unique sets of genes interacting and caste-specific expression differing for many genes in the heatmaps (Fig 3) and networks (Fig 4). For example, patterns of gene expression in the correlation networks (Fig 4) were consistent with interactions between the pre-optic area/arcuate nucleus in the context of GnRH regulation by KNDy neurons seen in other species [28, 34±35, 90] and appeared to be enhanced in females as compared to males. Specifically, in the arcuate nucleus, Gpr147 was a larger node in females than in males; this brain region expresses the Gpr147 ligand, RFRP-3, at 12 / 25 Fig 6. Relative mRNA expression of stress-related genes +/- standard error of the mean. A) Crhr2, NAcc: OS animals had highest expression, p = 0.035, irrespective of sex. B) Crhr2, Arc: SUB animals had higher expression than BRE, irrespective of sex, p = 0.040. C) Crhr2, MeA: SUB animals had higher expression than all other groups, p = 0.023. D) Crhr2, PVN: Significant sex-by-group interaction (p = 0.042) revealed BRE males had higher expression relative to SUB females (p = 0.017) and SUB males (p = 0.027) and a trend for higher expression than BRE females (p = 0.06). E) Nr3c1, DHipp: SUB animals had higher expression than OS, p = 0.026. F) Nr3c1, PVN: Significant sex-by-group interaction (p = 0.002) revealed OS females had higher expression relative to SUB males (p = 0.033) and BRE females (p = 0.023), and a trend for higher expression relative to SUB females (p = 0.067) and OS males (p = 0.062). (a) signifies statistical difference (p<0.05) from (b). NAcc = nucleus accumbens, Arc = arcuate nucleus/median eminence; MeA = medial amygdala; PVN = paraventricular/dorsomedial nucleus, VHipp = ventral hippocampus, DHipp = dorsal hippocampus, BRE = breeder, SUB = subordinate, OS = opposite sex paired. higher levels in subordinates than breeders [75] and could be reflecting greater reproductive suppression in females. In both sexes, Kiss1 was also highly correlated with Pdyn/Kor in the arcuate nucleus, inferring possible up-regulation of these ligands relative to Kiss1 to maintain suppression. While KNDy neurons have not been phenotyped in naked mole-rats, this pattern is consistent with other species, in which dynorphin signalling inhibits GnRH release [39±40, 91±92]. In males, but not females, there was a triadic relationship between Tac3, Tac3r and Crhr1 in the arcuate nucleus, with Tac3r also being highly correlated to Crhr2 and Nr3c1; in females, only Tac3r and Nr3c1 were correlated. This suggests possible increased importance for Tac3/Tac3r in linking the HPA and HPG axes in males as compared to females, as has been suggested previously by Grachev et al. [41]. Sex differences in gene expression extend beyond the arcuate nucleus. There was an increased importance of gonadal gene expression, specifically the Nr3c1 node, in the male network, whereas females had more connections between hippocampus (both dorsal and ventral) and other regions. Sex differences were also observed in the paraventricular nucleus and nucleus accumbens, discussed in more detail below. Collectively, these sex differences could indicate the neuroendocrine signals and brain regions regulating pubertal delay function in a sex-specific manner. A role for the nucleus accumbens in pubertal onset? The nucleus accumbens likely plays an important role in reproductive maturation and/or social status transitions in naked mole-rats. We have previously reported an interaction between sex and status for oxytocin receptor binding in this region with breeding males tending to have higher receptor density than breeding females [89]. Kisspeptin-immunoreactive processes and CRHR1 receptor binding are present in both sexes [74, 84] though there is little to no androgen receptor immunoreactivity in either sex [88]. Here, we report that males had greater Kiss1, Npvf, Gpr147 and Tac3r mRNA expression than females and that these sex differences often appeared larger in subordinates than in breeders (Fig 5). Several other genes also followed this pattern, but failed to reach statistical significance (see S1 Table). Although the nucleus accumbens is typically studied for its role in the mesocorticolimbic circuitry associated with pleasure, reward and motivation [93±98], a smaller number of studies have investigated the nucleus accumbens in peri-puberty. In humans, nucleus accumbens volume decreases across the Tanner stages, although males exhibit a transient volumetric increase [99] and nucleus accumbens responsiveness to reward differs between adolescents and adults [100]. Alterations to the nucleus accumbens in pre- and peri-pubertal female prairie voles and male rats disrupts social processing, eliminating or reducing behaviors such as social attachment, alloparenting and social novelty seeking [101±102]. Thus, sex-specific changes in gene expression in the nucleus accumbens during naked mole-rat reproductive and social transitions could be associated with shifts in valence of psychosocial stimuli. Given the increased aggression directed towards subordinate females [103±105], the relatively lower nucleus accumbens gene expression in subordinate females might be equivalent to adolescents in whom 14 / 25 Fig 7. Circulating levels of hormones reported as ng/mL +/- SEM. A) Progesterone was significantly elevated in females (p = 0.001) and BRE (p<0.0001), with this effect driven by breeding females specifically (p = 0.001). B) Testosterone was significantly elevated in males (p = 0.01) overall, but this was driven by significant elevation in BRE and OS, but not SUB males (p = 0.001). C) Cortisol was significantly elevated in males (p = 0.048), with OS animals approaching a statistically significant elevation in circulating cortisol (p = 0.066). (a) signifies statistical difference (p<0.05) from (b). BRE = breeder, SUB = subordinate, OS = opposite sex paired. accumbens hypoactivation and depression are associated with early life stress [106]. However, because gene expression levels are largely comparable between subordinate and breeding females, we propose the sex differences in gene expression in the nucleus accumbens stem from male hyperactivation, and not female hypoactivation, due to increased stress responsiveness in males. Crosstalk between HPG and HPA axes In human and rat studies, adolescent and adult males show greater HPA responsiveness to (social) stress than females, with this male ªstress hyperactivationº being more prominent in pre-pubertal male rats as compared to adult male rats [107±108]. The paraventricular nucleus is imperative to establishing social status effects due to its widely-explored associations with both stress [101±104] and socio-sexual behaviours [109±112]. In this study, we identified various sex-by-status interaction effects in the paraventricular/dorsomedial nuclei at the mRNA transcript level. The paraventricular nucleus is one possible region at the crossroads between the HPA and HPG axes in subordinate naked mole-rats, reacting to stress-related stimuli to delay pubertal timing. Both the paraventricular and dorsomedial nuclei of the hypothalamus express RFRP-3 in subordinates of both sexes [75]. At the mRNA transcript level, subordinate males have increased levels of the RFRP-3 receptor Gpr147 relative to females, suggesting that GnRH suppression in subordinate males could originate from signalling from the paraventricular nucleus. Interestingly, a sex difference favoring males was observed in breeders (with males having higher expression of Tac3r and Nr3c1) whereas the sex difference was reversed in OS animals, with OS females having higher expression of Tac3r and Nr3c1 relative to males. This reversal could be associated with peri-pubertal exposure to stress and changes in stress responsiveness [113±115]. Peri-pubertal stress results in Crhr1-mediated social deficits (Wister Han rats) [113] and increased responsiveness through corticotropin releasing hormone (mice) [116±117] or corticosterone (Fischer rats) [118]. Similar to the paraventricular nucleus, the present data indicate the arcuate nucleus integrates HPA axis signalling with the HPG axis through putative KNDy neuron regulation. As with the paraventricular nucleus, the arcuate nucleus expresses more RFRP-3 in subordinates compared to breeders [75] and we report here that subordinates have higher Crhr2 as compared to breeders in this region. Ralph et al. [52] hypothesized that the HPA axis inhibits HPG signalling and thus reproduction via the KNDy population in the arcuate nucleus. Stress signals are potentially acting through Tac3/Tac3r in the arcuate nucleus, which interestingly is the node with the highest degree in the networks for both sexes (Fig 4). Grachev et al. [54] showed that corticotropin releasing hormone is communicating an inhibitory signal to Tac3 in the arcuate nucleus to suppress the LH surge in female rats; however, this effect only occurs when animals are exposed to acute stress via lipopolysaccharide. We suggest that social stress might be triggering a similar mechanism (i.e., corticotropin releasing hormone and neurokinin B in the arcuate nucleus) to ultimately suppress HPG function in subordinate naked molerats. The relationship between stress and social/reproductive status in naked mole-rats is not simple. Subordinates can but do not always have higher levels of cortisol than do breeders 16 / 25 [119±121] and animals show evidence of reproductive activation in the presence of increased circulating cortisol (present data, [70±71]). In the bluehead wrasse (Thalassoma bifasciatum), the release from stress hypothesis suggests that a decrease in baseline HPI axis (equivalent to mammalian HPA axis) activity following removal of social stress allows for the initiation of female to male sex change [122]. Given the importance of social ascent in the life history of fish and putatively naked mole-rats, a role for the HPI/HPA axis is consistent with other life history transitions such as metamorphosis or smoltification [45]. In the bluebanded goby (Lythyrpnus dalli), social hierarchies led by a dominant male and female show the dominant female has elevated cortisol relative to the dominant male, while subordinates have intermediate cortisol levels relative to dominants [123]. In Astatotilapia burtoni, which also has sociallymediated reproductive suppression, subordinate animals released from suppression have elevated corticotropin-releasing hormone and its type 1 receptor within 15 minutes in both the pre-optic area and pituitary [124]. Furthermore, modifications to the glucocorticoid receptors appear to compensate for elevated cortisol levels in A. burtoni subordinates [125]. The present data suggest that similar status-specific HPA signaling occurs in naked mole-rats, including alterations in gene expression triggered by release from suppression. Another intriguing similarity between the A. burtoni model of reproductive suppression and the naked mole-rat is the identification of the nucleus accumbens for processing of related social stimuli. Dopaminergic control of GnRH1 neurons has been identified in the ventral telencephalon, a proposed nucleus accumbens homologue, which is known to facilitate social cognition in A. burtoni subordinates [126±127]. Together, these data from two diverse vertebrate species (the teleost A. burtoni and the mammalian naked mole-rat) suggest a conserved importance for the nucleus accumbens in socially-mediated reproductive suppression. Opposite-sex paired animals provide insight into reproductive and social transitions The OS group was originally included as a transition group to tease apart reproduction and social status differences at the molecular level. These animals were released from the suppressive cues of their natal colony but had not yet produced their own pups. Indeed, we identified expression differences between groups where a subset of the genes quantified matched either subordinate or breeder expression profiles. Interestingly, we also identified a large number of genes whose expression pattern matches neither subordinate nor breeding animals (Fig 3). These genes might represent a unique pattern of expression required for pubertal transitions or, more likely in our opinion, a response to relative social isolation. Removal from the colony and social pairing increases circulating cortisol, which can persist for at least one month (present data; 76) and is coincident with reproductive activation [70]. Thus, relative social isolation might trigger a stress response independent of pubertal onset. Studying additional time points during the transition, in addition to varying the degree of social isolation (e.g., removing and co-housing multiple animals simultaneously), will help shed light on this issue. Conclusions and future directions To our knowledge, this work is the first investigation of how reproduction- and stress-related genes are expressed upstream of GnRH in naked mole-rats, providing insight into mechanisms of socially-controlled pubertal onset across brain regions. We suggest that this process occurs in a sexually differentiated manner and identify gene candidates for future directed hypothesis testing. Indeed, several genes (e.g. Tac3, Crhr2, Nr3c1) warrant future focused investigation for understanding how neuroendocrine circuits can indefinitely suppress puberty in this 17 / 25 species. Future studies should examine puberty onset in naked mole-rats using genome-wide techniques to identify novel genes and pathways involved in socially-controlled reproductive suppression and subsequent activation. Building on the nodes identified herein, we can begin to work outwards to connect the pathways and develop sex-specific pubertal gene regulatory networks. Supporting information S1 Datasheet. Summary of all normalized data. Summary of all data used in analyses: indi vidual gene qPCR relative expression, hormonal assays, weight, age, experimental group and sex. OS = opposite-sex paired animal, PVN = paraventricular and dorsomedial nucleus, NAcc = nucleus accumbens, Arc = arcuate nucleus/median eminence, POA = pre-optic area, DHipp = dorsal hypothalamus, VHipp = ventral hypothalamus, MeA = medial amygdala. (XLSX) S1 Table. Summary of all sex-by-group ANOVA results. Statistical significance is considered based on the critical alpha 0.05 (p<0.05). The experimental group exhibiting greater expression is specified in brackets following the factor for significant results only. An asterisk denotes a region in which the gene was not analyzed. SxG = Sex by group, B = BRE, S = SUB, OS = OS, M = Male, F = Female, PVN = paraventricular and dorsomedial nucleus, NAcc = nucleus accumbens, Arc = arcuate nucleus/median eminence, POA = pre-optic area, DHipp = dorsal hypothalamus, VHipp = ventral hypothalamus, MeA = medial amygdala. (PDF) Acknowledgments Thank you to Diana E. Peragine for help with the ELISAs and Amber A. Azam for helping with sample preparation for quantitative PCR. Author Contributions Conceptualization: Mariela Faykoo-Martinez, D. Ashley Monks, Iva B. Zovkic, Melissa M. Holmes. Formal analysis: Mariela Faykoo-Martinez, D. Ashley Monks, Iva B. Zovkic, Melissa M. Holmes. Funding acquisition: D. Ashley Monks, Iva B. Zovkic, Melissa M. Holmes. Investigation: Mariela Faykoo-Martinez. Resources: Mariela Faykoo-Martinez, D. Ashley Monks, Iva B. Zovkic, Melissa M. Holmes. Software: Mariela Faykoo-Martinez. Supervision: Melissa M. Holmes. Validation: Mariela Faykoo-Martinez, Melissa M. Holmes. Visualization: Mariela Faykoo-Martinez. Writing ± original draft: Mariela Faykoo-Martinez, Melissa M. Holmes. Writing ± review & editing: Mariela Faykoo-Martinez, D. Ashley Monks, Iva B. Zovkic, Melissa M. Holmes. 18 / 25 19 / 25 20 / 25 21 / 25 63. Jarvis JUM. Eusociality in a mammal: cooperative breeding in naked mole-rat colonies. Science. 1981: 212(4494); 573±5. 22 / 25 23 / 25 24 / 25 1. Day FR , Elks CE , Murray A , Ong KK , Perry JR . Puberty timing associated with diabetes, cardiovascular disease and also diverse health outcomes in men and women: the UK Biobank study . Sci Rep . 2015 ; 5 : 11208 . https://doi.org/10.1038/srep11208 PMID: 26084728 2. Palmert MR , Dunkel L. Clinical practice. Delayed puberty . N Engl J Med . 2012 ; 366 : 443 ± 53 . https:// doi.org/10.1056/NEJMcp1109290 PMID: 22296078 3. Wierson ML , Long PJ , Forehand RL . Toward a new understanding of early menarche: The role of environmental stress in pubertal timing . Adolescence . 1993 ; 28 : 912 . 4. Mendle J , Turkheimer E , D'Onofrio BM , Lynch SK , Emery R.E. , Slutske W.S. , and Martin N.G. ( 2006 ). Family structure and age at menarche: a children-of-twins approach . Dev Psychol . 2006 ; 42 : 533 ± 42 . https://doi.org/10.1037/ 0012 - 1649 . 42 .3.533 PMID: 16756443 5. Ellis BJ , Garber J . Psychosocial antecedents of variation in girls' pubertal timing: maternal depression, stepfather presence, and marital and family stress . Child Dev . 2000 ; 71 : 485 ± 501 . PMID: 10834479 6. Wierson M , Long PJ , Forehand RL . Toward a new understanding of early menarche: the role of environmental stress in pubertal timing . Adolescence . 1993 ; 28 : 913 ± 24 . PMID: 8266844 7. Hulanicka B . Acceleration of menarcheal age of girls from dysfunctional families . J Reprod Infant Psychol . 1999 ; 17 : 14 . 8. Arim RG , Tramonte L , Shapka JD , Dahinten VS , Willms JD . The family antecedents and the subsequent outcomes of early puberty . J Youth Adolesc . 2011 ; 40 : 1423 ± 35 . https://doi.org/10.1007/ s10964-011 -9638-6 PMID: 21298330 9. Brommer JE , Merila J , Kokko H . Reproductive timing and individual fitness . Ecol Lett . 2002 ; 5 : 802 ± 10 . 10. Alicea B. Evolution in eggs and phases: experimental evolution of fecundity and reproductive timing in Caenorhabditis elegans . R Soc Open Sci . 2016 ; 3 ( 11 ): 160496 . https://doi.org/10.1098/rsos.160496 PMID: 28018635 11. Sun Y , Mensah FK , Azzopardi P , Patton GC , Wake M. Childhood social disadvantage and pubertal timing: A national birth cohort from Australia . Pediatrics . 2017 ; 139 . 12. Malina RMK , Bonci CM , Ryan RC , Wellens RE . Family size and age at menarche in athletes . Med Sci Sports Exerc . 1997 ; 29 : 7 . 13. Jones B , Leeton J , McLeod I , Wood C . Factors influencing the age of menarche in a lower socio-economic group in Melbourne . Med J Aust. 1972 ; 2 : 533 ± 5 . PMID: 5083191 14. Kim KS , Smith PK . Retrospective survey of parental marital relations and child reproductive development . Int J Behav Dev . 1998 ; 22 ( 4 ): 22 . 15. Kim KS , Smith PK . Family relations in early childhood and reproductive development . J Reprod Infant Psychol . 1999 ; 17 : 16 . 16. Hunter DJ , Spiegelman D , Adami HO , van den Brandt PA , Folsom AR , Goldbohm RA , Graham S , Howe GR , Kushi LH , Marshall JR , Miller AB , Speizer FE , Willett W , Wolk A , Yaun SS . Non-dietary factors as risk factors for breast cancer, and as effect modifiers of the association of fat intake and risk of breast cancer . Cancer Cause Control . 1997 ; 8 : 49 ± 56 . 17. Wilson ME , Kinkead B . Gene-environment interactions, not neonatal growth hormone deficiency, time puberty in female rhesus monkeys . Biol Reprod . 2008 ; 78 ( 4 ): 736 ± 43 . https://doi.org/10.1095/ biolreprod.107.065953 PMID: 18160679 18. Trillmich F , Mueller B , Kaiser S , Krause J . Puberty in female cavies (Cavia aperea) is affected by photoperiod and social conditions . Physiol Behav . 2009 ; 96 ( 3 ): 476 ± 80 . https://doi.org/10.1016/j.physbeh. 2008 . 11 .014 PMID: 19087883 19. Vandenbergh JG . Regulation of puberty and its consequences on population-dynamics of mice . Am Zool . 1987 ; 27 : 891 ± 8 . 20. Prebeg Z , Bralic I. Changes in menarcheal age in girls exposed to war conditions . Am J Hum Biol . 2000 ; 12 : 503 ±8. https://doi.org/10.1002/ 1520 - 6300 ( 200007 /08)12: 4 < 503 : :AID-AJHB10>3.0 .CO;2 -H PMID : 11534042 21. Tahirovie HF . Menarchal age and the stress of war: an example from Bosnia . Eur J Pediatr . 1998 ; 157 : 978 ± 80 . PMID: 9877035 22. Belsky J , Steinberg L , Draper P . Childhood experience, interpersonal development, and reproductive strategy: an evolutionary theory of socialization . Child Dev . 1991 ; 62 : 647 ± 70 . PMID: 1935336 23. Kelly Y , Zilanawala A , Sacker A , Hiatt R , Viner R . Early puberty in 11-year-old girls: millennium cohort study findings . Arch Dis Child . 2017 ; 102 ( 3 ): 232 ±7. https://doi.org/10.1136/archdischild-2016 -310475 PMID: 27672135 24. Sun Y , Mensah FK , Azzopardi P , Patton GC , Wake M. Childhood social disadvantage and pubertal timing: a national birth cohort from Australia . Pediatrics . 2017 ; 139 ( 6 ):e20164099. https://doi.org/10. 1542/peds.2016-4099 PMID: 28562276 25. Wierson M , Long PJ , Forehand RL . Toward a new understanding of early menarche: the role of environmental stress in pubertal timing . Adolescence . 1993 ; 28 ( 112 ): 913 . PMID: 8266844 26. Goubillon M , Delaleu B , Tillet Y , Caraty A , Herbison AE . Localization of estrogen-receptive neurons projecting to the GnRH neuron-containing rostral preoptic area of the ewe . Neuroendocrinology . 1999 ; 70 : 228 ± 36 . https://doi.org/10.1159/000054481 PMID: 10529617 27. Schally AV , Arimura A , Kastin AJ , Matsuo H , Baba Y , Redding TW , et al. Gonadotropin-releasing hormone: one polypeptide regulates secretion of luteinizing and follicle-stimulating hormones . Science . 1971 ; 173 : 1036 ± 8 . PMID: 4938639 28. Lehman M.N. , Coolen L.M. , Goodman R.L. Minireview : kisspeptin/neurokinin b/dynorphin (KNDy) cells of the arcuate nucleus: a central node in the control of gonadotropin releasing hormone secretion . Endocrinology . 2010 ; 151 ( 8 ): 3479 ± 89 . https://doi.org/10.1210/en.2010-0022 PMID: 20501670 29. Ahn T , Fergani C , Coolen LM , Padmanabhan V , Lehman MN . Prenatal testosterone excess decreases neurokinn 3 receptor immunoreactivity within the arcuate nucleus KNDy cell population . J Neuroendocrinol . 2015 ; 27 ( 2 ): 100 ± 10 . https://doi.org/10.1111/jne.12244 PMID: 25496429 30. Cheng G , Coolen LM , Padmanabhan V , Goodman RL , Lehman MN . The kisspeptin/neurokinin B/ dynorphin (KNDy) cell population of the arcuate nucleus: sex differences and effects of prenatal testosterone in sheep . Endocrinology . 2010 ; 151 ( 1 ): 301 ± 11 . https://doi.org/10.1210/en.2009-0541 PMID: 19880810 31. Mittleman-Smith MA , Krajewski SJ , McMullen NT , Rance NE . Ablation of KNDy neurons results in hypogonadotropic hypogonadism and amplifies the steroid-induced LH surge in female rats . Endocrinology . 2016 ; 157 ( 5 ): 2015 ±27. https://doi.org/10.1210/en.2015-1740 PMID: 26937713 32. Topaloglu AK , Kotan LD , Yuksei B. Neurokinin B signaling in human puberty . J Neuroendocrinol . 2010 ; 22 : 767 ± 70 . 33. Gill JC , Navarro VM , Kwong C , Noel SD , Martin C , Xu S , Clifton DK , Carroll RS , Steiner RA , Kaiser UB . Increased neurokinin B (Tac2) expression in the mouse arcuate nucleus is an early marker of pubertal onset with differential sensitivity to sex steroid-negative feedback than Kiss1 . Neuroendocrinology . 2012 ; 153 ( 10 ): 4883 ± 93 . 34. Navarro VM , Ruiz-Pino F , Sanchez-GaÂrrido MA , GarcÂõa-Galiano D , Hobbs SJ , Manfredi-Lozano M , LeoÂn S , Sangiao-Alvarellos S , Castellano JM , Clifton DK , Pinilla L , Steiner RA , Tena-Sempere M , Role of neurokinin B in the control of female puberty and its modulation by metabolic status . J Neurosci . 2012 ; 32 ( 7 ): 2388 ± 97 . https://doi.org/10.1523/JNEUROSCI.4288- 11 . 2012 PMID: 22396413 35. Hu G , Lin C , He M , Wong AOL . Neurokinin B and reproductive functions: ªKNDy neuronº model in mammals and emerging story in fish . Gen Comp Endocrinol . 2014 ; 208 : 94 ± 108 . https://doi.org/10. 1016/j.ygcen. 2014 . 08 .009 PMID: 25172151 36. Dungan HM , Clifton DK , Steiner RA . Kisspeptin neurons as central processors in the regulation of gonadotropin-releasing hormone secretion . Endocrinology . 2006 ; 147 : 1154 ±8. https://doi.org/10. 1210/en.2005-1282 PMID: 16373418 37. Pineda R , Garcia-Galiano D , Roseweir A , Romero M , Sanchez-Garrido MA , Ruiz-Pino F , Morgan K , Pinilla L , Millar RP , Tena-Sempere M . Critical roles of kisspeptins in female puberty and preovulatory gonadotropin surges as revealed by a novel antagonist . Endocrinology . 2010 ; 151 ( 2 ): 722 ± 30 . https:// doi.org/10.1210/en.2009-0803 PMID: 19952274 38. Smith JT , Li Q , Sing Yap K , Shahab M , Roseweir AK , Millar RP , Clarke IJ . Kisspeptin is essential for the full preovulatory LH surge and stimulates GnRH release from the isolated ovine median eminence . Endocrinology . 2011 ; 152 ( 3 ): 1001 ± 12 . https://doi.org/10.1210/en.2010-1225 PMID: 21239443 39. Goodman RL , Coolen LM , Anderson GM , Hardy SL , Valent M , Connors JM , Fitzgerald ME , Lehman MN . Evidence that dynorphin plays a major role in mediating progesterone negative feedback on gonadotropin-releasing hormone neurons in sheep . Endocrinology . 2004 ; 145 ( 6 ): 2959 ± 67 . https://doi. org/10.1210/en.2003-1305 PMID: 14988383 40. Goodman RL , Hileman SM , Nestor CC , Porter KL , Connors JM , Hardy SL , Millar RP , Cernea M , Coolen LM , Lehman MN . Kisspeptin, neurokinin B , and dynorphin act in the arcuate nucleus to control activity of the GnRH pulse generator in ewes . Endocrinology . 2013 ; 154 ( 11 ): 4259 ± 69 . https://doi.org/ 10.1210/en.2013-1331 PMID: 23959940 41. Grachev P , Li XF , Hu MH , Li SY , Millar RP , Lightman SL , O'Byrne KT . Neurokinin B signalling in the female rat: a novel link between stress and reproduction . Neuroendocrinology . 2014 ; 155 ( 7 ): 2589 ± 601 . 42. Han X , He Y , Zeng G , Wang Y , Sun W , Liu J , Sun Y , Yu J . Intracerebroventricular injection of RFRP-3 delays puberty onset and stimulates growth hormone secretion in females rats . Reprod Biol Endocrinol . 2017 ; 15 ( 1 ): 35 . https://doi.org/10.1186/s12958-017 -0254-5 PMID: 28464910 43. Poling MC , Kauffman AS . Regulation and function of RFRP-3 (GnIH) neurons during postnatal development . Front Endocrinol (Lausanne) . 2015 ; 6 : 150 . https://doi.org/10.3389/fendo. 2015 .00150 PMID: 26441840 44. Xiang W , Zhang B , Lv F , Ma Y , Chen H , Chen L , Yang F , Wang P , Chu M. The inhibitory effects of RFamide-related peptide 3 on luteinizing hormone release involves an estradiol-dependent manner in prepubertal but not in adult female mice . Biol Reprod . 2015 ; 93 ( 2 ): 30 . https://doi.org/10.1095/ biolreprod.115.128777 PMID: 26063871 45. Wada H. Glucocorticoids : mediators of vertebrate ontogenetic transitions . Gen Comp Endocrinol . 2008 ; 156 : 441 ± 53 . https://doi.org/10.1016/j.ygcen. 2008 . 02 .004 PMID: 18359027 46. Smith JT , Waddell B.J. 2000 . Increased fetal glucocorticoid exposure delays puberty onset in postnatal life . Endocrinology . 141 ( 7 ), 2422 ± 2428 . https://doi.org/10.1210/endo.141.7.7541 PMID: 10875242 47. Kinouchi R , Matsuzaki T , Iwasa T , Gereltsetseg G , Nakazawa H , Kunimi K , Kuwahara A , Yasui T , Irahara M. Prepubertal exposure to glucocorticoid delays puberty independent of hypothalamic Kiss1- GnRH system in female rats . Int J Dev Neurosci . 2012 ; 30 ( 7 ): 596 ± 601 . https://doi.org/10.1016/j. ijdevneu. 2012 . 09 .001 PMID: 22982503 48. Kinsey-Jones JS , Li XF , Knox AM , Lin YS , Milligan SR , Lightman SL , O'Byrne KT . Corticotrophinreleasing factor alters the timing of puberty in the female rat . J Neuroendcrinol . 2010 ; 22 ( 2 ): 102 ± 9 . 49. Lim WL , Idris MM , Kevin FS , Soga T , Parhar IS . Maternal dexamethasone exposure alters synaptic inputs to gonadotropin-releasing hormone neurons in the early postnatal rat . Front Endocrinol (Lausanne) . 2016 ; 7 : 117 . 50. Lim WL , Soga T , Parhar IS . Maternal dexamethasone exposure during pregnancy in rats disrupts gonadotropin-releasing hormone neuronal development in the offspring . Cell Tissue Res . 2014 ; 355 ( 2 ): 409 ± 423 . https://doi.org/10.1007/s00441-013 -1765-9 PMID: 24374911 51. Soga T , Dalpatadu SL , Wong DW , Parhar IS . Neonatal dexamethasone exposure down-regulates GnRH expression through GnIH pathway in female mice . Neuroscience . 2012 ; 218 : 56 ± 64 . https://doi. org/10.1016/j.neuroscience. 2012 . 05 .023 PMID: 22626647 52. Ralph CR , Lehman MN , Goodman RL , Tillbrook AJ . Impact of psychosocial stress on gonadotrophins and sexual behavior in females: role for cortisol? Reproduction . 2016 ; 152 ( 1 ):R1± 14 . https://doi.org/ 10.1530/REP-15-0604 PMID: 27069009 53. Luo E , Stephens SB , Chaing S , Munaganuru N , Kauffman AS , Breen KM . Corticosterone blocks ovarian cyclicity and the LH surge via decreased kisspeptin neuron activation in female mice . Endocrinology . 2016 ; 157 ( 3 ): 1187 ± 99 . https://doi.org/10.1210/en.2015-1711 PMID: 26697722 54. Grachev P , Millar RP , O'Byrne KT . The role of neurokinin B signaling in reproductive neuroendocrinology . Neuroendocrinology . 2014 ; 99 ( 1 ):7± 17 . https://doi.org/10.1159/000357734 PMID: 24356581 55. Doremus-Fitzwater TL , Varlinskaya EI , Spear LP . Social and non-social anxiety in adolescent and adult rats after repeated restraint . Physiol Behav . 2009 ; 97 : 484 ± 94 . https://doi.org/10.1016/j.physbeh. 2009 . 03 .025 PMID: 19345235 56. Green M , McCormick C . Sex and stress steroids in adolescence: gonadal regulation of the hypothalamic-pituitary-adrenal axis in the rat . Gen Comp Endocrinol . 2016 ; 234 : 110 ±6. https://doi.org/10. 1016/j.ygcen. 2016 . 02 .004 PMID: 26851306 57. Gunnar MR , Wewerka S , Frenn K , Long JD , Griggs C . Developmental changes in hypothalamus-pituitary-adrenal activity over the transition to adolescence: normative changes and associations with puberty . Dev Psychopathol . 2009 ; 21 : 69 ± 85 . https://doi.org/10.1017/S0954579409000054 PMID: 19144223 58. Handa RJ , Weiser MJ . Gonadal steroid hormones and the hypothalamo-pituitary-adrenal axis . Front Neuroendocrinol . 2014 ; 35 : 197 ± 220 . https://doi.org/10.1016/j.yfrne. 2013 . 11 .001 PMID: 24246855 59. Mathews IZ , Wilton A , Styles A , McCormick CM . Heightened neuroendocrine function in males to a heterotypic stressor and increased depressive behaviour in females after adolescent social stress in rats . Behav Brain Res . 2008 ; 190 : 33 ± 40 . https://doi.org/10.1016/j.bbr. 2008 . 02 .004 PMID: 18342957 60. McCormick CM , Smith C , Mathews IZ . Effects of chronic social stress in adolescence on anxiety and neuroendocrine response to mild stress in male and female rats . Behav Brain Res . 2008 ; 187 : 228 ± 38 . https://doi.org/10.1016/j.bbr. 2007 . 09 .005 PMID: 17945360 61. Romeo RD , Lee SJ , McEwen BS . Differential stress reactivity in intact and ovariectomized prepubertal and adult female rats . Neuroendocrinology . 2004 ; 80 : 387 ± 93 . https://doi.org/10.1159/000084203 PMID: 15741744 62. Viau V , Bingham B , Davis J , Lee P , Wong M. Gender and puberty interact on the stress-induced activation of parvocellular neurosecretory neurons and corticotropin-releasing hormone messenger ribonucleic acid expression in the rat . Endocrinology . 2005 ; 146 : 137 ± 46 . https://doi.org/10.1210/en.2004- 0846 PMID: 15375029 64. Faulkes CG , Abbott DH . Social control of reproduction in breeding and non-breeding male naked mole-rats (Heterocephalus glaber) . J Reprod Fertil . 1991 ; 93 ( 2 ): 427 ± 35 . PMID: 1787462 65. Faulkes CG , Abbott DH , Jarvis JUM . Social suppression of reproduction in male naked mole-rats, Heterocephalus glaber . J Reprod Fertil . 1991 ; 91 ( 2 ): 593 ± 604 . PMID: 2013881 66. Clark FM , Faulkes CG . Dominance and queen succession in captive colonies of the eusocial naked mole-rat, Heterocephalus glaber . Proc R Soc Lond B . 1997 ; 264 , 993 ± 1000 . 67. Holmes MM , Goldman BD , Goldman SL , Seney ML , Forger NG . Neuroendocrinology and sexual differentiation in eusocial mammals . Front Neuroendocrinol . 2009 ; 30 ( 4 ): 519 ± 33 . https://doi.org/10. 1016/j.yfrne. 2009 . 04 .010 PMID: 19416733 68. Margulis SW , Saltzman W , Abbott DH . Behavioral and hormonal changes in female naked mole-rats (Heterocephalus glaber) following removal of the breeding female from a colony . Horm Behav . 1995 ; 29 ( 2 ): 227 ± 47 . https://doi.org/10.1006/hbeh. 1995 .1017 PMID: 7557925 69. Holmes MM , Rosen GJ , Jordan CL , de Vries GJ , Goldman BD , Forger, NG. Social control of brain morphology in a eusocial mammal . Proc Natl Acad Sci USA . 2007 ; 104 ( 25 ): 10548 ± 52 . https://doi.org/ 10.1073/pnas.0610344104 PMID: 17556547 70. Swift-Gallant A , Mo K , Peragine DE , Monks DA , Holmes MM . Removal of reproductive suppression reveals latent sex differences in brain steroid hormone receptors in naked mole-rats, Heterocephalus glaber . Biol Sex Differ . 2015 ; 6 : 31 . https://doi.org/10.1186/s13293-015-0050 -x PMID : 26693002 71. Peroulakis ME , Goldman B , Forger NG . Perineal muscles and motoneurons are sexually monomorphic in the naked mole-rat (Heterocephalus glaber) . J Neurobiol . 2002 ; 51 ( 1 ): 33 ± 42 . PMID: 11920726 72. Seney ML , Kelly DA , Goldman BD , Sumbera R , Forgery NG . Social structure predicts genital morphology in African mole-rats . PLoS One . 2009 ; 4 ( 10 ):e7477. https://doi.org/10.1371/journal.pone. 0007477 PMID: 19829697 73. Faulkes CG , Abbott DH , Jarvis JUM , Sherriff FE . LH responses of female naked mole-rats, Heterocephalus glaber, to single and multiple doses of exogenous GnRH . J Reprod Fertil . 1990 ; 89 : 317 ± 23 . PMID: 2197410 74. Zhou S , Holmes MM , Forger NG , Goldman BD , Lovern MB , Caraty A , et al. Socially regulated reproductive development: analysis of GnRH-1 and kisspeptin neuronal systems in cooperatively breeding naked mole-rats (Heterocephalus glaber) . J Comp Neurol . 2013 ; 521 ( 13 ): 3003 ± 29 . https://doi.org/10. 1002/cne.23327 PMID: 23504961 75. Peragine DE , Pokarowski M , Mendoza-Viveros L , Swift-Gallant A , Cheng HYM , Bentley GE , et al. RFamide-related peptide-3 (RFRP-3) suppresses sexual maturation in a eusocial mammal . Proc Natl Acad Sci USA . 2017 ; 114 ( 5 ): 1207 ± 12 . https://doi.org/10.1073/pnas.1616913114 PMID: 28096421 76. Peragine DE , Yousuf Y , Fu Y , Swift-Gallant A , Ginzberg K , Holmes MM . Contrasting effects of opposite- versus same-sex housing on hormones, behaviour and neurogenesis in a eusocial mammal . Horm Behav . 2016 ; 91 : 28 ± 37 . 77. Warnes GR , Bolker B , Bonebakker L , Gentleman R , Huber W , Liaw A , et al. gplots: Various R Programming Tools for Plotting Data . R package version 3.0.1 . 2016 . Available from: https://CRAN.Rproject.org/package=gplots 78. Harrell Jr FE. Hmisc: Harrell Miscellaneous. R package version 4 .0± 3 . 2017 . Available from: https:// CRAN.R-project.org/package=Hmisc. 79. Shannon P , Markiel A , Ozier O , Baliga NS , Wang JT , Ramage D , et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks . Genome Res . 2003 ; 13 ( 11 ): 2498 ± 504 . https://doi.org/10.1101/gr.1239303 PMID: 14597658 80. Doncheva NT , Assenov Y , Domingues FS , Albrecht M. Topological analysis and interactive visualization of biological networks and protein structures . Nat Protoc . 2012 ; 7 : 670 ± 85 . https://doi.org/10.1038/ nprot. 2012 .004 PMID: 22422314 81. Revelle W. psych: Procedures for Personality and Psychological Research . Evanston, USA; 2017 . Available from: https://CRAN.R-project.org/package=psych. 82. Wickham H. ggplot2: Elegant Graphics for Data Analysis . Springer-Verlag: New York, USA; 2016 . 83. Henry EC , Dengler-Crish CM , Catania KC . Growing out of a caste±reproduction and the making of the queen mole-rat . J Exp Biol . 2007 ; 210 : 261 ±8. https://doi.org/10.1242/jeb.02631 PMID: 17210962 84. Beery AK , Bicks L , Mooney SJ , Goodwin NL , Holmes MM . Sex, social status and CRF receptors densities in naked mole-rats . J Comp Neurol . 2016 ; 524 : 228 ± 43 . https://doi.org/10.1002/cne.23834 PMID: 26100759 85. Hathaway GA , Faykoo-Martinez M , Peragine DE , Mooney SJ , Holmes MM . Subcaste differences in neural activation suggest a prosocial role for oxytocin in eusocial naked mole-rats . Horm Behav . 2016 ; 79 : 1±7 . https://doi.org/10.1016/j.yhbeh. 2015 . 12 .001 PMID: 26718226 86. Holmes M.M. , Goldman B.D. , Forger N.G. 2008 . Social status and sex independently influence androgen receptor expression in the eusocial naked mole-rat brain . Hormones and Behavior . 54 , 278 ± 285 . https://doi.org/10.1016/j.yhbeh. 2008 . 03 .010 PMID: 18455726 87. Holmes MM , Seney ML , Goldman BD , Forger NG . Social and hormonal triggers of neural plasticity in naked mole-rats . Behav Brain Res . 2011 ; 218 ( 1 ): 234 ±9. https://doi.org/10.1016/j.bbr. 2010 . 11 .056 PMID: 21130812 88. Mooney SJ , Holmes MM . Social condition and oxytocin neuron number in the hypothalamus of naked mole-rats (Heterocephalus glaber) . Neuroscience . 2013 ; 230 : 56 ± 61 . https://doi.org/10.1016/j. neuroscience. 2012 . 11 .014 PMID: 23200787 89. Mooney SJ , Coen CW , Holmes MM , Beery AK . Region-specific associations between sex, social status, and oxytocin receptor density in the brains of eusocial rodents . Neuroscience . 2015 ; 303 : 261 ±9. https://doi.org/10.1016/j.neuroscience. 2015 . 06 .043 PMID: 26143015 90. Grachev P , Porter KL , Coolen LM , McCosh RB , Connors JM , Hileman SM , Lehman MN , Goodman RL . Surge-like luteneizing hormone secretion induced by retrochiasmatic area NK3R activation is mediated primarily by arcuate kisspeptin neurones in the ewe . J Neuroendocrinol . 2016 ; 28 ( 6 ). https:// doi.org/10.1111/jne.12393 PMID: 27059932 91. Gallo RV . Kappa-opioid receptor involvement in the regulation of pulsatile luteinizing hormone release during early pregnancy in the rat . J Neuroendocrinol . 1990 ; 2 : 685 ± 91 . https://doi.org/10.1111/j.1365- 2826 . 1990 .tb00465. x PMID: 19215406 92. Wakabayashi Y , Nakada T , Murata K , Ohkura S , Mogi K , Navarro VM , Clifton DK , Mori Y , Tsukamura H , Maeda K , Steiner RA , Okamura H. Neurokinin B and dynorphin A in kisspeptin neurons of the arcuate nucleus participate in generation of periodic oscillation of neural activity driving pulsatile gonadotropin- releasing hormone secretion in the goat . J Neurosci . 2010 ; 30 : 3124 ± 32 . https://doi.org/10.1523/ JNEUROSCI.5848- 09 . 2010 PMID: 20181609 93. Nicola SM . The flexible approach hypothesis: unification of effort and cue-responding hypothesis for the role of nucleus accumbens dopamine in the activation of reward-seeking behavior . J Neurosci . 2010 ; 30 : 16585 ± 600 . https://doi.org/ 10 . 2010 PMID: 21147998 94. Azogu I , Plamondon H . Inhibition of TrkB at the nucleus accumbens using ANA-12, regulates basal and stress-induced orexin A expression within the mesolimbic system and affects anxiety, sociability and motivation . Neuropharmacology . 2017 ; 125 : 129 ± 45 . https://doi.org/10.1016/j.neuropharm. 2017 . 07 .008 PMID: 28705440 95. Basso JC , Morrell JI . The medial prefrontal cortex and nucleus accumbens mediate the motivation for voluntary wheel running in the rat . Behav Neurosci . 2015 ; 129 ( 4 ): 457 ± 72 . https://doi.org/10.1037/ bne0000070 PMID: 26052795 96. Clithero JA , Reeck C , Mckell CR , Smith DV , Huettel SA . Nucleus accumbens mediates relative motivation for rewards in the absence of choice . Front Hum Neurosci . 2011 ; 5 : 87 . https://doi.org/10.3389/ fnhum. 2011 .00087 PMID: 21941472 97. Koch M , Schmid A , Schnitzler HU . Pleasure-attenuation of startle is disrupted by lesions of the nucleus accumbens . Neuroreport . 1996 ; 7(8):1442±6 . PMID: 8856694 98. Sabatinelli D , Bradley MM , Lang PJ , Costa VD , Versace F . Pleasure rather than salience activates human nucleus accumbens and medial prefrontal cortex . J Neurophysiol . 2007 ; 98 ( 3 ): 1375 ± 9 . 99. Goddings AL , Mills KL , Clasen LS , Giedd JN , Viner RM , Blakemore SJ . The influence of puberty on subcortical brain development . Neuroimage . 2014 ; 88 : 242 ± 51 . https://doi.org/10.1016/j.neuroimage. 2013 . 09 .073 PMID: 24121203 100. Ernst M , Nelson EE , Jazbec S , McClure EB , Monk CS , Leibenluft E , Blair J , Pine DS . Amygdala and nucleus accumbens in responses to receipt and omissions of gains in adults and adolescents . Neuroimage . 2005 ; 25 : 1279 ± 91 . https://doi.org/10.1016/j.neuroimage. 2004 . 12 .038 PMID: 15850746 101. Tendilla-BeltraÂn H , Arroyo-Garcia LE , Diaz A , Camacho-Abrego I , de la Cruz F , RodrÂõguez-Moreno A , Flores G. The effects of amphetamine exposure on juvenile rats on the neuronal morphology of the limbic system at prepubertal, pubertal and postpubertal ages . Journal of Chemical Neuroanatomy . 2016 ; 77 : 68 ± 77 . https://doi.org/10.1016/j.jchemneu. 2016 . 05 .004 PMID: 27208629 102. Keebaugh AC , Barrett CE , Laprairie JL , Jenkins JJ , Young LJ . RNAi knockdown of oxytocin receptor in the nucleus accumbens inhibits social attachment and parental care in monogamous female prairie voles . Social Neuroscience . 2015 ; 10 ( 5 ): 561 ± 70 . https://doi.org/10.1080/17470919. 2015 .1040893 PMID: 25874849 103. Clarke FM and Faulkes CG . 2001 . Intracolony aggression in the eusocial naked mole-rat, Heterocephalus glaber . Animal Behaviour . 61 ( 2 ), 311 ± 324 . 104. Reeve HK . 1992 . Queen activation of lazy workers in colonies of the eusocial naked mole-rat . Nature . 1992 ; 358 ( 6382 ): 147 ±9. https://doi.org/10.1038/358147a0 PMID: 1614546 105. Stankowich T , Sherman PW . 2002 . Pup shoving by adult naked mole-rats . Ethology . 2002 ; 108 ( 11 ): 975 ± 92 . 106. Goff B , Gee DG , Telzer EH , Humphreys KL , Gabard-Durnam L , Flannery J , Tottenham N. Reduced nucleus accumbens reactivity and adolescent depression following early-life stress . Neuroscience . 2013 ; 249 : 129 ± 38 . https://doi.org/10.1016/j.neuroscience. 2012 . 12 .010 PMID: 23262241 107. McCormick CM , Green MR , Simone JJ . Translational relevance of rodent models of hypothalamicpituitary-adrenal function and stressors in adolescence . Neurobiol Stress . 2017 ; 6 : 31 ± 43 . https://doi. org/10.1016/j.ynstr. 2016 . 08 .003 PMID: 28229107 108. Klein ZA , Padow VA , Romeo RD . The effects of stress on play and home cage behaviors in adolescent male rats . Dev Psychobiol . 2010 ; 52 ( 1 ): 62 ± 70 . https://doi.org/10.1002/dev.20413 PMID: 19937741 109. Flak JN , Ostrander MM , Tasker JG , Herman JP . Chronic stress-induced neurotransmitter plasticity in the PVN . J Comp Neurol . 2009 ; 517 ( 2 ): 156 ± 65 . https://doi.org/10.1002/cne.22142 PMID: 19731312 110. Kiss A , Palkovits M , Aguilera G. Neural regulation of corticotropin releasing hormone (CRH) and CRH receptor mRNA in the hypothalamic paraventricular nucleus in the rat . J Neuroendocrinol . 1996 ; 8 ( 2 ): 103 ± 12 . PMID: 8868257 111. Kubota N , Amemiya S , Yanagita S , Nishijima T , Kita I. Emotional stress evoked by classical fear conditioning induces yawning behavior in rats . Neurosci Lett . 2014 ; 566 : 182 ±7. https://doi.org/10.1016/j. neulet. 2014 . 02 .064 PMID: 24631429 112. Weiser MJ , Osterlund C , Spencer RL . Inhibitory effects of corticosterone in the hypothalamic paraventricular nucleus (PVN) on stress-induced adrenocorticotrophic hormone secretion and gene expression in the PVN and anterior pituitary . J Neuroendocrinol . 2011 ; 23 ( 12 ): 1231 ± 40 . https://doi.org/10. 1111/j.1365- 2826 . 2011 . 02217 . x PMID : 21910768 113. Veenit V , Riccio O , Sandi C. CRHR1 links peripuberty stress with deficits in social and stress-coping behaviors . J Psychiatr Res . 2014 ; 53 : 1±7 . https://doi.org/10.1016/j.jpsychires. 2014 . 02 .015 PMID: 24630468 114. Foilb AR , Lui P , Romeo RD . The transformation of hormonal stress responses throughout puberty and adolescence . J Endocrinol . 2011 ; 210 : 391 ±8. https://doi.org/10.1530/JOE-11-0206 PMID: 21746793 115. Romeo RD . Pubertal maturation and programming of hypothalamic-pituitary-adrenal reactivity . Front. Neuroendocrinol . 2010 ; 32 : 232 ± 40 . 116. Li XF , Bowe JE , Kinsey-Jones JS , Brain SD , Lightman SL , O'Byrne KT. Differential role of corticotrophin-releasing factor receptor types 1 and 2 in stress-induced suppression of pulsatile luteinizing hormone secretion in the female rat . J Neuroendocrinol . 2006 ; 18 : 602 ± 610 . https://doi.org/10.1111/j. 1365- 2826 . 2006 . 01450 . x PMID : 16867181 117. Toth M , Flandreau EI , Deslauriers J , Geyer MA , Mansuy IM , Pich EM , Risbrough VB . Overexpression of forebrain CRH during early life increases trauma susceptibility in adulthood . Neuropsychopharmacology . 2016 ; 41 : 1681 ± 90 . https://doi.org/10.1038/npp. 2015 .338 PMID: 26538448 118. Lowrance SA , Ionadi A , McKay E , Douglas X , Johnson JD . Sympathetic nervous system contributes to enhanced corticosterone levels following chronic stress . Psychoneuroendocrinology . 2016 ; 68 : 163 ± 70 . https://doi.org/10.1016/j.psyneuen. 2016 . 02 .027 PMID: 26974501 119. Clarke FM , Faulkes CG . Dominance and queen succession in captive colonies of the eusocial naked mole-rat, Heterocephalus glaber . Proc Royal Soc B . 1997 ; 264 ( 1384 ): 933 ± 1000 . 120. Clarke FM , Faulkes CG . Hormonal and behavioural correlates of male dominance and reproductive status in captive colonies of the naked mole-rat, Heterocephalus glaber . Proc Royal Soc B . 1998 ; 265 ( 1404 ): 1391 ± 9 . 121. Faulkes CG , Abbott DH . The physiology of a reproductive dictatorship: regulation of male and female reproduction by a single breeding female in colonies of naked mole-rats. 122. Perry AN , Grober MS . A model for social control of sex change: interactions of behavior, neuropeptides, glucocorticoids, and sex steroids . Horm Behav . 2003 ; 43 ( 1 ): 31 ± 8 . PMID: 12614632 123. Solomon-Lane TK , Crespi EJ , Grober MS . Stress and serial adult metamorphosis: multiple roles for the stress axis in socially regulated sex change . Front Neurosci . 2013 ; 7 : 210 . https://doi.org/10.3389/ fnins. 2013 .00210 PMID: 24265604 124. Carpenter RE , Maruska KP , Becker L , Fernald RD . Social opportunity rapidly regulates expression of CRF and CRF receptors in the brain during social ascent of a teleost fish, Astatotilapia burtoni . Plos ONE . https://doi.org/10.1371/journal.pone.0096632 125. Korzan WJ , Grone BP , Fernald RD . Social regulation of cortisol receptor gene expression . J Exp Biol . 2014 ; 217 ( 18 ): 3221 ± 8 . 126. Bryant AS , Greenwood AK , Juntti SA , Byrne AE , Fernald RD . Dopaminergic inhibition of gonadotropin-releasing hormone neurons in the cichlid fish, Astatotilapia burtoni . J Exp Biol . 2016 ; jeb.147637. 127. O 'Connell LA , Ding JH , Hofmann HA . Sex differences and similarities in the neuroendocrine regulation of social behavior in an African cichlid fish . Horm Behav . 2013 ; 64 ( 3 ): 468 ± 76 . https://doi.org/10.1016/ j.yhbeh. 2013 . 07 .003 PMID: 23899762


This is a preview of a remote PDF: http://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0193417&type=printable

Mariela Faykoo-Martinez, D. Ashley Monks, Iva B. Zovkic, Melissa M. Holmes. Sex- and brain region-specific patterns of gene expression associated with socially-mediated puberty in a eusocial mammal, PLOS ONE, 2018, DOI: 10.1371/journal.pone.0193417