Sequencing of complete mitochondrial genomes confirms synonymization of Hyalomma asiaticum asiaticum and kozlovi, and advances phylogenetic hypotheses for the Ixodidae

PLOS ONE, May 2018

Phylogeny of hard ticks (Ixodidae) remains unresolved. Mitochondrial genomes (mitogenomes) are increasingly used to resolve phylogenetic controversies, but remain unavailable for the entire large Hyalomma genus. Hyalomma asiaticum is a parasitic tick distributed throughout the Asia. As a result of great morphological variability, two subspecies have been recognised historically; until a morphological data-based synonymization was proposed. However, this hypothesis was never tested using molecular data. Therefore, objectives of this study were to: 1. sequence the first Hyalomma mitogenome; 2. scrutinise the proposed synonymization using molecular data, i.e. complete mitogenomes of both subspecies: H. a. asiaticum and kozlovi; 3. conduct phylogenomic and comparative analyses of all available Ixodidae mitogenomes. Results corroborate the proposed synonymization: the two mitogenomes are almost identical (99.6%). Genomic features of both mitogenomes are standard for Metastriata; which includes the presence of two control regions and all three "Tick-Box" motifs. Gene order and strand distribution are perfectly conserved for the entire Metastriata group. Suspecting compositional biases, we conducted phylogenetic analyses (29 almost complete mitogenomes) using homogeneous and heterogeneous (CAT) models of substitution. The results were congruent, apart from the deep-level topology of prostriate ticks (Ixodes): the homogeneous model produced a monophyletic Ixodes, but the CAT model produced a paraphyletic Ixodes (and thereby Prostriata), divided into Australasian and non-Australasian clades. This topology implies that all metastriate ticks have evolved from the ancestor of the non-Australian branch of prostriate ticks. Metastriata was divided into three clades: 1. Amblyomminae and Rhipicephalinae (Rhipicephalus, Hyalomma, Dermacentor); 2. Haemaphysalinae and Bothriocrotoninae, plus Amblyomma sphenodonti; 3. Amblyomma elaphense, basal to all Metastriata. We conclude that mitogenomes have the potential to resolve the long-standing debate about the evolutionary history of ticks, but heterogeneous evolutionary models should be used to alleviate the effects of compositional heterogeneity on deep-level relationships.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

http://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0197524&type=printable

Sequencing of complete mitochondrial genomes confirms synonymization of Hyalomma asiaticum asiaticum and kozlovi, and advances phylogenetic hypotheses for the Ixodidae

May Sequencing of complete mitochondrial genomes confirms synonymization of Hyalomma asiaticum asiaticum and kozlovi, and advances phylogenetic hypotheses for the Ixodidae Zhi-Qiang Liu 0 1 Yan-Feng Liu 0 1 Nuer Kuermanali 1 Deng-Feng Wang 1 Shi-Jun Chen 1 Hui-Ling Guo 1 Li Zhao 1 Jun-Wei Wang 1 Tao Han 1 Yuan-Zhi Wang 1 Jie Wang 1 Chen- Feng Shen 1 Zhuang-Zhi Zhang 1 Chuang-Fu Chen 0 1 0 College of Animal Science and Technology, Shihezi University , Shihezi, Xinjiang Uygur Autonomous Region , China , 2 Institute of Veterinary Medicine, Xinjiang Academy of Animal Science , Urumqi, Xinjiang Uygur Autonomous Region , China , 3 School of Medicine, Shihezi University , Shihezi, Xinjiang Uygur Autonomous Region , China 1 Editor: Ulrike Gertrud Munderloh, University of Minnesota , UNITED STATES Phylogeny of hard ticks (Ixodidae) remains unresolved. Mitochondrial genomes (mitogenomes) are increasingly used to resolve phylogenetic controversies, but remain unavailable for the entire large Hyalomma genus. Hyalomma asiaticum is a parasitic tick distributed throughout the Asia. As a result of great morphological variability, two subspecies have been recognised historically; until a morphological data-based synonymization was proposed. However, this hypothesis was never tested using molecular data. Therefore, objectives of this study were to: 1. sequence the first Hyalomma mitogenome; 2. scrutinise the proposed synonymization using molecular data, i.e. complete mitogenomes of both subspecies: H. a. asiaticum and kozlovi; 3. conduct phylogenomic and comparative analyses of all available Ixodidae mitogenomes. Results corroborate the proposed synonymization: the two mitogenomes are almost identical (99.6%). Genomic features of both mitogenomes are standard for Metastriata; which includes the presence of two control regions and all three "Tick-Box" motifs. Gene order and strand distribution are perfectly conserved for the entire Metastriata group. Suspecting compositional biases, we conducted phylogenetic analyses (29 almost complete mitogenomes) using homogeneous and heterogeneous (CAT) models of substitution. The results were congruent, apart from the deep-level topology of prostriate ticks (Ixodes): the homogeneous model produced a monophyletic Ixodes, but the CAT model produced a paraphyletic Ixodes (and thereby Prostriata), divided into Australasian and non-Australasian clades. This topology implies that all metastriate ticks have evolved from the ancestor of the non-Australian branch of prostriate ticks. Metastriata was divided into three clades: 1. Amblyomminae and Rhipicephalinae (Rhipicephalus, Hyalomma, Dermacentor); 2. Haemaphysalinae and Bothriocrotoninae, plus Amblyomma sphenodonti; 3. Amblyomma elaphense, basal to all Metastriata. We conclude that mitogenomes have the - funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. potential to resolve the long-standing debate about the evolutionary history of ticks, but heterogeneous evolutionary models should be used to alleviate the effects of compositional heterogeneity on deep-level relationships. Introduction Ticks (Chelicerata: Ixodida) are one of the medically most important groups of arthropods; as obligate hematophagous parasites of terrestrial vertebrates, they are vectors of several very important diseases. Despite their medical and veterinary importance, genetic resources for ticks remain relatively limited and our understanding of tick evolution merely fragmental [1± 5]. Among the three extant families of ticks, only two are of importance for public health: Ixodidae (the hard ticks) and Argasidae (the soft ticks) [ 6 ]. Due to unsuitability of morphological traits for the task and limited genetic resources currently available, phylogeny and taxonomy of Ixodidae remain unresolved. On the basis of morphological differences, the hard ticks are divided into two groups: ProstriataÐcontaining only the Ixodinae subfamily, and Metastriata Ðcontaining a debated number of genera (around 13) classified into a debated number of subfamilies (4 or 5) [5,7±9]. Among the metastriate ticks, species belonging to the large (27 currently recognized species) Hyalomma Koch 1844 genus are distributed from tropical Africa to Siberia [ 10,11 ]. Species of this genus infest mammals, birds and reptiles; and they are vectors of several important viruses and rickettsial organisms [12]. Hyalomma asiaticum Schulze and Schlottke 1930 is a tick species common almost in the entire Asia, which transmits a number of different diseases and exhibits great morphological variability [ 10,13 ]. This has historically caused a number of taxonomic controversies, including proposals of a varying number of subspecies [10]. Two of these subspecies, H. a. asiaticum and kozlovi, were considered valid until a relatively recent study proposed their synonymization on the basis of morphological characters [ 10 ]. However, this hypothesis was never tested using molecular data. Although the phylogeny of Ixodida has been studied using a number of molecular markers, both mitochondrial and nuclear [ 9,14,15 ], the resolution that these single molecular markers provide appears to be too low to unequivocally resolve the evolutionary history of this group of animals. Mitochondrial genomes (mitogenomes) carry a large amount of data, which makes them capable of providing much higher resolution than traditionally used morphological and single-gene molecular markers, and therefore mitochondrial phylogenomics is increasingly used to address controversial phylogenetic relationships [16±18]. Mitochondrial phylogenomics has also been used to study the phylogeny of ticks [3,19±21], but its applicability remains hampered by the unavailability of mitogenomes for many large taxonomic categories, including the entire Hyalomma genus. As it appears that a much larger amount of molecular data will have to be available in order fully resolve the evolutionary history of hard ticks, the objective of this study was to sequence the first Hyalomma mitogenome. Additionally, as Apanaskevich and Horak [ 10 ] did not use any molecular data to support their synonymization of two H. asiaticum subspecies (asiaticum and kozlovi), we have set out to corroborate their proposition using mitogenomic data. To achieve this, we sampled specimens morphologically corresponding to the two subspecies [ 6,10,22 ] and sequenced their mitogenomes. Following this, we conducted comparative and phylogenomic analyses using all available hard tick mitogenomes. Results and discussion The two mitogenomes are almost identical, with identity of 99.6% (merely 48 variable sites were found), and only four gaps in the alignment. Previously, sequence difference between 2 / 14 two complete mitogenomes of a closely related species, Rhipicephalus sanguineus (one specimen from China and one from the USA), was found to be 11.23%, thereby leading the authors to propose that these are two different species [ 20 ]. We can therefore make exactly the opposite conclusion, that the sequencing of these two mitogenomes has corroborated the morphologybased hypothesis [ 10 ] that Hyalomma asiaticum asiaticum (S1 Fig) and H. a. kozlovi (S2 Fig) should be synonymized to Hyalomma asiaticum. Genome architecture The complete mitochondrial genome of H. a. asiaticum (Haa; GenBank accession number: MF101817) is 14 720 bp-long, whereas that of H. a. kozlovi (Hak; MF101818) is four bp longer Ð14 724. Both mitogenomes possess the standard 13 protein-coding genes, two rRNA genes (16S and 12S), 22 tRNA genes and two control regions. The mean AT and GC skews are -0.027 and -0.144 respectively. All these characteristics are standard for ticks (S1 File) [ 3,5,9,20 ]. The A+T content (78.1% Haa, 78.2% Hak) is also average for this group of animals: metastriate ticks have the A+T content between 75 and 80%, whereas soft ticks have a somewhat lower A+T content of 70±75% [ 3,5,9,20 ]. In terms of gene order and strand distribution, the ancestral arthropod architecture (Limulus polyphemus in Fig 1) has remained unchanged for over 400 million years in the lineages leading to the prostriate ticks (two Ixodes clades in Fig 1) [ 8,23 ]. In metastriate ticks, a block of seven genes (nad1-trnL2-rrnL-trnV-rrnS-trnI-trnQ) was translocated, some tRNAs were rearranged (Fig 1), and two large non-coding (control) regions are usually present [7±9,23]. However, gene order and strand distribution within this group (metastriate ticks), which includes the two new mitogenomes as well, are perfectly conserved (Fig 1). The only exception is Amblyomma trigutatum, where nad1 and tRNA-Glu have switched places; but as this mitogenome remains unpublished, we don't exclude a possibility of an annotation mistake (we are quite confident that tRNA-Ser2 on the minority strand in A. fimbriatum, where tRNA-Ser1 should be on the majority strand, is an annotation artefact). Fig 1. Mitochondrial phylogenomics and mitogenomic architecture of the Ixodidae family. Phylogenetic dendrogram was constructed using nucleotide sequences of almost complete 29 available Ixodidae mitogenomes. Heterogeneous CAT model implemented in PhyloBayes was used to conduct the Bayesian inference analysis. Limulus polyphemus is the outgroup. Scale bar corresponds to the estimated number of substitutions per site. Only the Bayesian probability values lower than 1.0 are shown next to corresponding nodes. Mitogenomic architecture is shown to the right of the corresponding sequences (the legend is incorporated in the figure). GenBank accession numbers are shown next to species names. Font colours correspond to subfamilies (according to the GenBank taxonomy), with full details available in the S1 File (supplementary data). 3 / 14 We found 13 intergenic regions (IGRs) and nine gene overlaps. IGRs ranged from 1 to 21 bp in size, with the longest located between the tRNA-Gln and tRNA-Phe genes (Table 1). The overlaps ranged from 1 to 8 bp, with the largest found between tRNA-Tyr/cox1 (8 bp), atp6/ atp8 (7 bp), and nad4/nad4L (7 bp). Although the possibility of annotation artefacts should not be excluded, the comparison of homologs in related species (S1 File) and almost identical numbers and sizes of overlaps and IGRs in some related species [ 20 ], do not provide any indication of this. Apart from two large overlaps, atp6/atp8 and nad4/nad4L, all other overlaps involved tRNA genes, which is common, and believed to be a consequence of lesser evolutionary constraints on tRNA sequences [ 24 ]. Identical overlaps of two PCGs (atp6/atp8 and nad4/ nad4L, both 7 bp) have been described in another metastriate tick, A. sculptum [ 21 ], but metastriate ticks belonging to the Rhipicephalus genus appear to exhibit only an identical (7 bp) atp6/atp8 overlap [ 20 ]. Both overlaps include very small genes (atp8 = 162 bp, nad4L = 276 bp), which appear to be under lesser evolutionary constraints, as atp8 is often absent from mitogenomes [ 25 ], whereas the nad4/nad4L overlap is common in mitogenomes of many different groups of animals [17,18,26±28]. Although annotation of the nad1 gene is usually very difficult in hard ticks, often producing unusually large gene overlaps [ 21,29 ], nad1 genes in the studied two mitogenomes are very similar to closely related Rhipicephalus orthologs (S1 File), with an overlap of only 4 bp with the neighbouring tRNA-Glu (Table 1). Gene sizes were identical between the two mitogenomes, and relatively standard for the entire Ixodidae group. Generally, gene sizes are highly conserved among the available Ixodidae mitogenomes, with most genes exhibiting a size-window smaller than 10 bp; exceptions are only nad2 and nad5 with approximately 30 bp size-windows (S1 File B worksheet). Regarding the two studied mitogenomes, the only outlier is nad5 gene (1641 bp), which is smaller than in other available orthologs, with only the Amblyomma americanum [ 3 ] ortholog exhibiting a similar size (1642 bp). Both studied mitogenomes used identical start and termination codons. The start codons used were ATG (6), ATA (4), and ATT (3), whereas the termination codons were TAA (9), T- -(3) and TAG (1), all of which are standard for ticks [ 9,20 ]. Intriguingly, atp8 used ATG, which is non-standard for this group of animals; it was reported only in Amblyomma americanum [3] and Ixodes hexagonus [ 7 ] among the available Ixodidae mitogenomes, whereas the rest of the species use ATT, ATC or ATA (S1 File, worksheet B). As observed in other ticks, two AT-rich or non-coding regions were found (CR1 and CR2, Table 1). Both are typical in terms of size (303 and 306 bp, respectively) and location (CR1Ðbetween the rrnS and tRNA-Ile, CR2 between tRNA-Leu-1 and tRNA-Cys) [ 7,9,20 ]. Tick-Boxes are two to three degenerate 17 bp-long motifs (ttgyrtchwwwtwwgda) discovered in tick mitogenomes, which are believed to be post-transcriptional regulatory elements, and might also have been involved in genome rearrangements [ 29 ]. Although the third box is not present in all metastriate ticks [ 3,29 ], all three boxes were found in the two studied mitogenomes (Table 1) exactly in the positions described before [29]. The six motifs were highly conserved; only two different sequences were found, differing by only a T$A mutation: TTGCATCATTTTTTGGA (both Tick-Boxes-1 and Haa Tick-Box-2) and TTGCATCAATTTT TGGA (both Tick-Boxes-3 and Hak Tick-Box-2). Phylogeny Overview of published phylogenetic studies reveals a notable variability in the topology produced (both in Prostriata and Metastriata clades) depending on the dataset and methodology used [ 3,5,8,9,19,20 ]. As differences are particularly pronounced between mitochondrial and nuclear datasets, we suspected that this might be an indication of the existence of either compositional heterogeneity in the mitogenomes of ticks, or possibly even mitochondrial 4 / 14 introgression in the evolutionary history of ticks [30]. Although recent evidence shows that the latter is more widespread than previously thought [31±33], previously observed effects of the 5 / 14 third codon position exclusion from mitochondrial PCGs [ 5,9 ] suggest that compositional heterogeneity is the more likely cause for this inconsistency. Mitochondrial genomes of some groups of animals, which also includes some Arthropoda, often exhibit compositional heterogeneity, or non-constant equilibrium nucleotide frequencies across different lineages, which is a major driver of artificial clustering (long-branch attraction) in phylogenetic analysis [34±36]. Therefore, homogeneous models of substitution, where all sites evolve under the same substitution process and constantly through time, may not be suitable for mitochondrial phylogenomics studies in ticks. Among the strategies designed to minimise these biases, site-heterogeneous mixture model (CAT), which allows flexible probabilities of the nucleotide replacement equilibrium frequencies, is considered to be the most effective [36]. Therefore, we have decided to test both the standard homogeneous model and a non-standard heterogeneous model on our dataset. The results they produced were mostly congruent, apart from the deep-level topology of prostriate ticks (Ixodes): the homogeneous model (S3 Fig) produced a monophyletic Ixodes subdivided into two sister-clades (Australasian and non-Australasian), whereas the heterogeneous CAT model produced a paraphyletic Ixodes (and thereby Prostriata) with very high nodal support (Fig 1). Although the monophyly of Ixodes has been questioned before [5,8,19,37±40], a majority of morphological and nuclear, and all mitochondrial (including the amino acid sequences) datasets, produced monophyletic Ixodes [ 3,5,8,9,19,20,39,41 ]. The fact that ours is the first study relying on mitochondrial data to produce paraphyletic Ixodes is in perfect agreement with the observation that impact of compositional heterogeneity is much more pronounced in deep-level phylogenies [36]. Paraphyletic Ixodes genus was produced in several studies using concatenated nuclear 18 and 28S gene datasets [ 5,8,19,37 ], but in these analyses non-Australian Ixodes group was basal to Australian Ixodes. The topology retrieved in our study, where Australian Ixodes clade was basal to the non-Australian Ixodes clade. Therefore, our results produced using the CAT heterogeneous model imply that all metastriate ticks have evolved from the ancestor of the non-Australian branch of prostriate ticks after it became separate from the Australian branch of Prostriata. These findings are very interesting from the aspect of a previously proposed hypothesis that ticks have originated in the Australasian region of Gondwanaland [ 38,40,42 ] (see [2] for detailed discussion). However, this intriguing hypothesis would have to be tested very carefully (regarding the methodology) using a much larger amount of both nuclear and mitochondrial molecular data. The rest of the topology did not produce novel findings, but it might help resolve a number of phylogenetic controversies. Metastriata was divided into two major clades: 1. Amblyomminae, Rhipicephalinae (Rhipicephalus and Dermacentor genera), and Hyalomminae; and 2. Haemaphysalinae and Bothriocrotoninae, plus Amblyomma sphenodonti. It should be noted that the taxonomy we used here is the one currently used for the GenBank entries. Our topology indicates that clade 1 should be subdivided into Amblyomminae (Amblyomma) and Rhipicephalinae (Rhipicephalus, Hyalomma, and Dermacentor genera). This is in agreement with some [ 3,5,9,19,41 ], and disagreement with other [ 8,20 ], previous studies, based on both nuclear and mitochondrial data. Unlike most previous studies [ 3,5,8,9,19 ], our topology does not support the existence of a particularly deep split between Haemaphysalinae and Bothriocrotoninae. However, our results do support the previously noted [ 5,19 ] deep division of the Haemaphysalis genus, and provides further support [ 5,19,20 ] for A. elaphense being basal to the rest of the Metastriata (albeit with a relatively low nodal support). However, the positions of these two species are extremely variable [ 5,9 ], their morphology still places them within their respective genera, mitochondrial introgression may have occurred in their evolutionary history, and we show here that analyses based on mitochondrial data may be affected by compositional heterogeneity; so these findings would have to be thoroughly supported by nuclear data before taxonomic changes can be proposed with confidence. 6 / 14 Intriguingly, most of the studies using 18S or concatenated nuclear 18S/28S datasets produced a paraphyletic Rhipicephalus (with Hyalomma at the bottom of the clade) [ 5,8,9,19 ]; and 18S dataset produced a sister clade relationship between Haemaphysalinae and Rhipicephalinae [8]. As our analyses did not produce any of these artefacts, this might be an evidence of a higher phylogenetic resolution conferred by the large mitogenomic dataset. However, a larger number of Rhipicephalus and Hyalomma mitogenomes would have to be available to make that conclusion with certainty. Conclusions As the absence of a sufficient number of sequenced mitogenomes is currently the foremost limiting factor for their application to infer the evolutionary history of ticks, we have sequenced the first mitogenome of two subspecies belonging to a large Hyalomma genus: H. asiaticum asiaticum and kozlovi. As the two sequenced mitogenomes are almost identical, our results corroborate the hypothesis of Apanaskevich and Horak [ 10 ] that the two subspecies should be synonymized. The results of our phylogenetic analysis imply that all metastriate ticks may have evolved from the ancestor of the non-Australian branch of prostriate ticks, but further analyses and more data shall be needed to corroborate this scenario. Although our results indicate that mitogenomes might have the potential to resolve the long-standing debate about the evolutionary history of ticks, the indication that compositional heterogeneity might affect the deep-level relationships strongly implies that future studies relying on the mitochondrial phylogenomics approach should combine homogeneous and heterogeneous evolutionary models in order to identify the long-branch attraction artefacts. Materials and methods Samples, identification, and DNA extraction Adult Hyalomma asiaticum asiaticum (Schulze and Schlottke, 1929) ticks (S1 Fig) were collected from the skin of free-range grazing sheep in Qitai County, Xidi town, Xinjiang Uygur Autonomous Region, China. Qitai County is located in the north-eastern Xinjiang, north of the Tianshan Mountains, south-eastern margin of the Junggar basin (89Ê13' - 91Ê22' E, 42Ê25' - 45Ê29' N). Adult Hyalomma asiaticum kozlovi (Olenev, 1931) ticks (S2 Fig) were collected from the skin of free-range grazing sheep in Karamay city, Xiaoguai village, Xinjiang Uygur Autonomous Region. Karamay is located at the north-western margin of the Junggar basin (84Ê44' - 86Ê01' E, 44Ê07' - 46Ê08' N). Sampling was conducted from February to April 2015. Live ticks were collected into a sample box, kept alive in the lab for 3±5 days to ensure they were starved, and then stored in 75% ethanol at 4ÊC. Specimens were morphologically identified under a dissecting microscope as described before [ 6,10,22 ]. After washing in sterile water, DNA was isolated from one specimen of each putative subspecies using Aidlab DNA extraction kit (Aidlab Biotechnologies, Beijing, China). As the study involved unregulated parasitic invertebrates, no permits were required to retrieve and process the samples. We collected the ticks from privately owned sheep, free-range grazing on public land (arid grasslands, and semi-desert). For this, we collaborated with local veterinary departments, which took us to the farmers (sheep owners) to obtain the verbal agreement to collect the parasites. Therefore, no written permits were issued. Genome sequencing and assembly Genomes were sequenced, assembled and annotated roughly following the procedure described before [ 18,28,43 ]. Ten primer pairs were designed (with approx. 100bp overlaps) to match the conserved regions of mitochondrial genes, and used to amplify and sequence the 7 / 14 Primer name LYF1 LYR1 LYF2 LYR2 LYF3 LYR3 LYF4 LYR4 LYF5 LYR5 LYF6 LYR6 LYF7 LYR7 LYF8 LYR8 LYF9 LYR9 LYF10 LYR10 Sequence (5'-3') GCTGGGATATTAGGTCTTAG GAGTGTTCGGAGGGAGGGAA GACGTTATTCAGATTACCCTG GGATAACAAGTTTGTTATCTG CTGATGAAACTTTTTCATCAC GAAACTATGATTTGCACCAC GGACAATCCCATCACTTGGG TTAGGAGACAATCTTCTATG GATGTCTCACGAGAAGCAAG GAAAGCCATGAAAACCAGTAG CAATTATTCTTGGGATTAC GACCCTAAGAATTTGAAGATC TACGCTGTTATCCCTAGAG CGTACCTTTAGCATTAGGG GAAAAGAATTTCACATCTAAAG CCAAAAGGGTTTCTTGATCC GCAATCCCATATATCGGTTC GAAAGTACCATTCAGGTTG CGATCATTTACCCTTATAGAC CGCCAATTATGATAGGTATAAC entire mitogenome (Table 2). Reaction volume of 50μL contained 5 U/μL of TaKaRa LA Taq polymerase (TaKaRa, Japan), 10×LATaq Buffer II, 2.5μM of dNTP mixture, 0.2±1.0μM of each primer, 60ng of DNA template, and PCR-grade H2O. Amplification was conducted under the following conditions: initial denaturation at 98ÊC for 2min, followed by 40 cycles at 98ÊC for 10s, 50ÊC for 15s, 68ÊC for 1 min/kb. If the product was not specific enough, PCR conditions were optimized: annealing temperature increased by two degrees and the number of cycles decreased to 35. PCR products were sequenced on an ABI 3730 automatic sequencer using Sanger method [ 44 ]. All obtained fragments were quality-proofed (electropherogram) and BLASTed [ 45 ] to confirm that the amplicon is the actual target sequence. Mitogenome was assembled stepwise manually with the help of DNAstar v7.1 [ 46 ] program, making sure that the overlaps were identical, and that no numts [ 47 ] were incorporated into the sequence. DNAstar was also used to locate the putative ORFs for protein-coding genes (PCGs). Then we used BLAST and BLASTx to compare the putative ORFs with published nucleotide and amino acid sequences of related species, and manually determine the actual initiation and termination codon positions. Annotation of tRNAs was performed using tRNAscan [ 48 ] and ARWEN [ 49 ] tools, and the results checked manually. The annotation was recorded in Word documents, and parsed and extracted using MitoTool software [ 50 ]. MitoTool was also used to create GenBank submission files and tables with statistics for mitogenomes. Annotated mitogenomes are available from the GenBank via accession numbers MF101817 (Haa) and MF101818 (Hak). Phylogenetic and comparative analyses For the comparative and phylogenetic analyses we have retrieved all 27 currently (Nov. 2017) available Ixodidae mitogenomes (S1 File) from the NCBI's non-redundant RefSeq database [ 51 ]. Sequence comparison (identity) between the two newly-sequenced mitogenomes was calculated using EMBL-EBI tools framework (Needle) [ 52 ]. For the phylogenetic analyses, 8 / 14 following previous studies [ 9,19 ], a basal arthropod, Limulus polyphemus (NC_003057) [53], was used as the outgroup. Fasta files with nucleotide sequences for all 37 genes (12 PCGs, 2 rRNAs and 22 tRNAs) were extracted from GenBank files using MitoTool. Nucleotide sequences of protein-coding genes (PCGs) were aligned in batches (using codon-alignment mode) with MAFFT [ 54 ] integrated into BioSuite [ 55 ]. As described before [ 17 ], RNAs were aligned by Q-INS-i algorithm, which takes secondary structure information into account, incorporated into MAFFT-with-extensions software [ 56 ]. tRNAs Q, L1, L2, S1 and S2 were removed from the dataset for phylogenetic analysis because their annotation was not consistent in all mitogenomes. BioSuite was also used to concatenate these alignments and remove ambiguously aligned regions from the concatenated alignments by another plug-in program, GBlocks [ 57 ]. We used relaxed parameter settings [ 58 ] to maximize the amount of phylogenetic signal retained in the data: maximum/minimum number of sequences for a conserved/ flank position = 16 (all), maximum number of contiguous non-conserved positions = 8, minimum length of a block = 10, allowed gap positions = ªwith halfº. As a result, from the 15 408 positions in the original alignment, 12 690 (82%) remained. Selection of the most appropriate evolutionary model was computed using ModelFinder [ 59 ] and the IQ-TREE web interface [ 60 ]. All three algorithms (Akaike, Corrected Akaike, and Bayesian information criterion) produced identical best-fit model for a single partition: GY+F+I+G4 for nucleotide sequences of PCGs, TVM+G4 for rRNAs, and TIM2+I+G4 for tRNAs. This indicates that different parts of the mitogenome evolve under different rates. Furthermore, IQ-TREE performs a composition chi-square test for every sequence in the alignment, the purpose of which is to test for homogeneity of character composition: a sequence is denoted failed if its character composition significantly deviates from the average composition of the alignment [ 60 ]. Results of these analyses also indicated among-species compositional heterogeneity for concatenated PCGs (19 nucleotide sequences failed the composition chi2 test) and rRNAs (seven sequences failed the test). Regarding the concatenated tRNAs sequences, apart from L. polyphemus, all other sequences passed the chi2 test (S2 File). All these results indicate the existence of compositional heterogeneity, particularly among the PCG sequences, which can severely compromise the phylogenetic analysis [ 34,61 ]. Therefore, we have conducted the phylogenetic analysis using a program designed specifically to account for compositional heterogeneity, Phylobayes-MPI 1.7a [ 34,62 ], available from the beta version of the Cipres server (https://cushion3.sdsc.edu/ portal2/tools.action) [ 63 ]. The CAT-GTR site mixture model implemented in PhyloBayes allows for site-specific rates of mutation, which is considered to be a more realistic model of amino acid evolution, especially for large multi-gene alignments [ 64 ]. Two MCMC chains were run after the removal of invariable sites from the alignment, and the analysis stopped when the conditions considered to indicate a good run (PhyloBayes manual) were reached: maxdiff < 0.1 and minimum effective size > 300. Other parameters were default (burnin = 500). Alignment file used for the analysis is supplemented (S3 File). We also conducted a phylogenetic analysis using a standard, homogeneous, evolutionary model: Maximum Likelihood algorithm (with 1000 bootstrap replicates) implemented in raxmlGUI [ 65,66 ], on Cipres webserver [63]. Phylograms and gene orders were visualized and annotated by iTOL [ 67 ] using several dataset files generated by MitoTool, as described previously [ 18 ]. Supporting information S1 Fig. A typical Hyalomma asiaticum asiaticum specimen. (JPG) S2 Fig. A typical Hyalomma asiaticum kozlovi specimen. (JPG) 9 / 14 S3 Fig. Mitochondrial phylogenomics of the Ixodidae family inferred using Maximum Likelihood analysis. Phylogenetic dendrogram was constructed using nucleotide sequences of almost complete 29 available Ixodidae mitogenomes. Maximum Likelihood analysis was conducted using a homogeneous evolutionary model implemented in RaxML. The branch of the outgroup, Limulus polyphemus, has been shortened. Scale bar corresponds to the estimated number of substitutions per site. Bootstrap values are shown next to the corresponding nodes. GenBank accession numbers are shown next to species names, with full details available in the S1 File (supplementary data). (TIF) S1 File. Comparative analysis of Ixodidae mitogenomes. Worksheet A lists all species grouped by subfamilies (according to the GenBank taxonomy), with GenBank accession numbers, mitogenome sizes, base composition and skewness. Size, composition and skewness are also given for PCGs, rRNAs and tRNAs separately. Worksheet B lists gene sizes for all species, and their corresponding (putative) start and terminal codons. Species are represented by acronyms of their binomial scientific names. Worksheet C lists detailed base compositions of entire mitogenomes. (XLSX) S2 File. Composition chi-square test. Composition chi-square test performed by IQ-TREE for concatenated protein-coding genes (PCGs), rRNAs and tRNAs. A sequence is denoted failed if its character composition significantly deviates from the average composition of the alignment. (TXT) S3 File. Alignment used for the phylogenetic analyses. (TXT) Acknowledgments We would like to thank the anonymous reviewer for constructive and valuable comments. Author Contributions Conceptualization: Zhi-Qiang Liu, Yan-Feng Liu, Chuang-Fu Chen. Data curation: Zhi-Qiang Liu, Deng-Feng Wang, Jun-Wei Wang, Tao Han, Chen-Feng Shen. Formal analysis: Zhi-Qiang Liu, Li Zhao, Tao Han, Yuan-Zhi Wang. Funding acquisition: Zhi-Qiang Liu, Zhuang-Zhi Zhang. Investigation: Zhi-Qiang Liu, Shi-Jun Chen, Hui-Ling Guo, Li Zhao. Methodology: Zhi-Qiang Liu, Yan-Feng Liu, Nuer Kuermanali. Project administration: Zhi-Qiang Liu, Shi-Jun Chen, Chuang-Fu Chen. Resources: Zhi-Qiang Liu, Nuer Kuermanali, Chen-Feng Shen. Software: Yan-Feng Liu, Jie Wang. Supervision: Zhuang-Zhi Zhang, Chuang-Fu Chen. Validation: Zhi-Qiang Liu, Jun-Wei Wang. Visualization: Hui-Ling Guo, Jie Wang. 10 / 14 Writing ± original draft: Zhi-Qiang Liu, Yan-Feng Liu, Nuer Kuermanali, Deng-Feng Wang, Yuan-Zhi Wang. Writing ± review & editing: Zhi-Qiang Liu, Yan-Feng Liu, Shi-Jun Chen, Hui-Ling Guo, Li Zhao, Jun-Wei Wang, Tao Han, Yuan-Zhi Wang, Jie Wang, Chen-Feng Shen, Zhuang-Zhi Zhang, Chuang-Fu Chen. 11 / 14 26. 27. Wen HB, Cao ZM, Hua D, Xu P, Ma XY, Jin W, et al. The Complete Maternally and Paternally Inherited Mitochondrial Genomes of a Freshwater Mussel Potamilus alatus (Bivalvia: Unionidae). Waller RF, editor. PLoS One. Public Library of Science; 2017; 12: e0169749. https://doi.org/10.1371/journal.pone. 0169749 PMID: 28068380 Wang J-G, Zhang D, Jakovlić I, Wang W-MW-M, Gui J, Hwang D-F. Sequencing of the complete mitochondrial genomes of eight freshwater snail species exposes pervasive paraphyly within the Viviparidae family (Caenogastropoda). PLoS One. Public Library of Science (PLoS); 2017; 12: e0181699. https:// doi.org/10.1371/journal.pone.0181699 PMID: 28742843 12 / 14 13 / 14 1. Gibson AK , Smith Z , Fuqua C , Clay K , Colbourne JK . Why so many unknown genes? Partitioning orphans from a representative transcriptome of the lone star tick Amblyomma americanum . BMC Genomics . 2013 ; 14 : 1. https://doi.org/10.1186/ 1471 -2164-14-1 2. Mans BJ , de Castro MH , Pienaar R , de Klerk D , Gaven P , Genu S , et al. Ancestral reconstruction of tick lineages . Ticks Tick Borne Dis . 2016 ; 7 : 509 ± 535 . https://doi.org/10.1016/j.ttbdis. 2016 . 02 .002 PMID: 26868413 3. Williams-Newkirk AJ , Burroughs M , Changayil SS , Dasch GA . The mitochondrial genome of the lone star tick (Amblyomma americanum) . Ticks Tick Borne Dis. Urban & Fischer; 2015 ; 6 : 793 ± 801 . https:// doi.org/10.1016/j.ttbdis. 2015 . 07 .006 PMID: 26189992 4. Guglielmone AA , Robbins RG , Apanaskevich DA , Petney TN , Estrada-Peňa A , Horak IG , et al. The argasidae, Ixodidae and Nuttalliellidae (Acari: Ixodida) of the world: A list of valid species names . Zootaxa . 2010 ; 2528 : 1± 28 . https://doi.org/10.1023/A:1025381712339 5. Burger TD , Shao R , Barker SC . Phylogenetic analysis of the mitochondrial genomes and nuclear rRNA genes of ticks reveals a deep phylogenetic structure within the genus Haemaphysalis and further elucidates the polyphyly of the genus Amblyomma with respect to Amblyomma sphenodonti and A. Ticks Tick Borne Dis . 2013 ; 4 : 265 ± 274 . https://doi.org/10.1016/j.ttbdis. 2013 . 02 .002 PMID: 23602360 6. Mathison BA , Pritt BS . Laboratory identification of arthropod ectoparasites . Clin Microbiol Rev . 2014 ; 27 : 48 ± 67 . https://doi.org/10.1128/CMR.00008-13 PMID: 24396136 7. Black WC , Roehrdanz RL . Mitochondrial gene order is not conserved in arthropods: prostriate and metastriate tick mitochondrial genomes . Mol Biol Evol . 1998 ; 15 : 1772 ± 1785 . https://doi.org/10.1093/ oxfordjournals.molbev. a025903 PMID: 9866211 8. Mans BJ , de Klerk D , Pienaar R , de Castro MH , Latif AA . The Mitochondrial Genomes of Nuttalliella namaqua (Ixodoidea: Nuttalliellidae) and Argas africolumbae (Ixodoidae: Argasidae): Estimation of Divergence Dates for the Major Tick Lineages and Reconstruction of Ancestral Blood-Feeding Characters . PLoS One . 2012 ; 7: e49461 . https://doi.org/10.1371/journal.pone. 0049461 PMID: 23145176 9. Burger TD , Shao R , Beati L , Miller H , Barker SC . Phylogenetic analysis of ticks (Acari: Ixodida) using mitochondrial genomes and nuclear rRNA genes indicates that the genus Amblyomma is polyphyletic . Mol Phylogenet Evol . 2012 ; 64 : 45 ± 55 . https://doi.org/10.1016/j.ympev. 2012 . 03 .004 PMID: 22465402 10. Apanaskevich DA , Horak IG . The genus Hyalomma . XI. Redescription of all parasitic stages of H. (Euhyalomma) asiaticum (Acari: Ixodidae) and notes on its biology . Exp Appl Acarol . 2010 ; 52 : 207 ± 220 . https://doi.org/10.1007/s10493-010 -9361-0 PMID: 20383566 11. Sands AF , Apanaskevich DA , Matthee S , Horak IG , Harrison A , Karim S , et al. Effects of tectonics and large scale climatic changes on the evolutionary history of Hyalomma ticks . Mol Phylogenet Evol . 2017 ; 114 : 153 ± 165 . https://doi.org/10.1016/j.ympev. 2017 . 06 .002 PMID: 28625763 12. Goddard J. PhysicianÂS Guide To Arthropods of Mecial Importance. Physician's guide to arthropods of medical importance . Boca Raton , Florida: CRC Press, Inc.; 1993 . https://doi.org/10.3201/eid1309. 070706 13. Chen Z , Li Y , Ren Q-Y , Luo J , Hu Y , Li K , et al. Morphological Characteristics of Normal and Gynandromorphic Hyalomma asiaticum Schulze and Schlottke , 1930 . Korean J Parasitol. 2015 ; 53 : 361 ± 364 . https://doi.org/10.3347/kjp. 2015 . 53 .3.361 PMID: 26174833 14. Black WC , Piesman J . Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences . Proc Natl Acad Sci U S A . 1994 ; 91 : 10034 ±8. https://doi.org/10.1073/pnas.91. 21.10034 PMID: 7937832 15. Black WC , Klompen JSH , Keirans JE . Phylogenetic Relationships among Tick Subfamilies (Ixodida: Ixodidae: Argasidae) Based on the 18S Nuclear rDNA Gene . Mol Phylogenet Evol . 1997 ; 7 : 129 ± 144 . https://doi.org/10.1006/mpev. 1996 .0382 PMID: 9007027 16. Cameron SL . Insect mitochondrial genomics: implications for evolution and phylogeny . Annu Rev Entomol . 2014 ; 59 : 95 ± 117 . https://doi.org/10.1146/annurev-ento- 011613 -162007 PMID: 24160435 17. Liu F-F , Li Y-P , Jakovlić I , Yuan X-Q . Tandem duplication of two tRNA genes in the mitochondrial genome of Tagiades vajuna (Lepidoptera: Hesperiidae) . EJE . 2017 ; 114 : 407 ± 415 . https://doi.org/10. 14411/eje. 2017 .052 18. Zhang D , Zou H , Wu SG , Li M , Jakovlić I , Zhang J , et al. Sequencing of the complete mitochondrial genome of a fish-parasitic flatworm Paratetraonchoides inermis (Platyhelminthes: Monogenea): tRNA gene arrangement reshuffling and implications for phylogeny . Parasit Vectors . 2017 ; 10 : 462 . https:// doi.org/10.1186/s13071-017 -2404-1 PMID: 29017532 19. Burger TD , Shao R , Labruna MB , Barker SC . Molecular phylogeny of soft ticks (Ixodida: Argasidae) inferred from mitochondrial genome and nuclear rRNA sequences . Ticks Tick Borne Dis . 2014 ; 5 : 195 ± 207 . https://doi.org/10.1016/j.ttbdis. 2013 . 10 .009 PMID: 24378079 20. Liu G-H , Chen F , Chen Y-Z , Song H-Q , Lin R-Q , Zhou D-H , et al. Complete Mitochondrial Genome Sequence Data Provides Genetic Evidence That the Brown Dog Tick Rhipicephalus sanguineus (Acari: Ixodidae) Represents a Species Complex . Int J Biol Sci . 2013 ; 9 : 361 ± 369 . https://doi.org/10.7150/ijbs. 6081 PMID: 23630448 21. de Lima PHC , Barcelos RM , Klein RC , Vidigal PMP , Montandon CE , Fabres-Klein MH , et al. Sequencing and comparative analysis of the Amblyomma sculptum mitogenome . Vet Parasitol . Elsevier; 2017 ; 247 : 121 ± 128 . https://doi.org/10.1016/j.vetpar. 2017 . 10 .007 PMID: 29080758 22. Yu X , Ye R-Y , Gong Z-D. The ticks fauna of Xinjiang . Urumqi: Xinjiang Scientific, Technological and Medical Publishing House; 1997 . 23. Shao R , Aoki Y , Mitani H , Tabuchi N , Barker SC , Fukunaga M. The mitochondrial genomes of soft ticks have an arrangement of genes that has remained unchanged for over 400 million years . Insect Mol Biol . 2004 ; 13 : 219 ± 224 . https://doi.org/10.1111/j.0962- 1075 . 2004 . 00447 . x PMID : 15157222 24. Doublet V , Ubrig E , Alioua A , Bouchon D , Marcade I , Marechal-Drouard L . Large gene overlaps and tRNA processing in the compact mitochondrial genome of the crustacean Armadillidium vulgare . RNA Biol . 2015 ; 12 : 1159 ± 1168 . https://doi.org/10.1080/15476286. 2015 .1090078 PMID: 26361137 25. Gissi C , Iannelli F , Pesole G . Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species . Heredity (Edinb) . 2008 ; 101 : 301 ± 320 . https://doi.org/10.1038/hdy. 2008 .62 PMID: 18612321 28. Zou H , Jakovlić I , Chen R , Zhang D , Zhang J , Li W-X , et al. The complete mitochondrial genome of parasitic nematode Camallanus cotti: extreme discontinuity in the rate of mitogenomic architecture evolution within the Chromadorea class . BMC Genomics . 2017 ; 18 : 840 . https://doi.org/10.1186/s12864- 017-4237 -x PMID : 29096600 29. Montagna M , Sassera D , Griggio F , Epis S , Bandi C , Gissi C. Tick-Box for 30-End Formation of Mitochondrial Transcripts in Ixodida, Basal Chelicerates and Drosophila . Ouzounis CA, editor. PLoS One. Public Library of Science; 2012 ; 7: e47538 . https://doi.org/10.1371/journal.pone. 0047538 PMID: 23077630 30. Rubinoff D , Holland BS , Savolainen V . Between Two Extremes: Mitochondrial DNA is neither the Panacea nor the Nemesis of Phylogenetic and Taxonomic Inference . Syst Biol . 2005 ; 54 : 952 ± 961 . https:// doi.org/10.1080/10635150500234674 PMID: 16385775 31. Jakovlić I , Wu Q-J , Treer T , SÏprem N , Gui J-F . Introgression evidence and phylogenetic relationships among three (Para)Misgurnus species as revealed by mitochondrial and nuclear DNA markers . Arch Biol Sci . 2013 ; 65 : 1463 ± 1467 . https://doi.org/10.2298/ABS1304463J 32. Edwards S V. , Potter S , Schmitt CJ , Bragg JG , Moritz C . Reticulation, divergence, and the phylogeography±phylogenetics continuum . Proc Natl Acad Sci . 2016 ; 113 : 8025 ± 8032 . https://doi.org/10.1073/ pnas.1601066113 PMID: 27432956 33. Mallet J , Besansky N , Hahn MW . How reticulated are species ? BioEssays . 2016 ; 38 : 140 ± 149 . https:// doi.org/10.1002/bies.201500149 PMID: 26709836 34. Lartillot N , Brinkmann H , Philippe H . Suppression of long-branch attraction artefacts in the animal phylogeny using a site-heterogeneous model . BMC Evol Biol . 2007 ; 7: S4 . https://doi.org/10.1186/ 1471 - 2148-7 -S1-S4 PMID : 17288577 35. Hassanin A. Phylogeny of Arthropoda inferred from mitochondrial sequences: Strategies for limiting the misleading effects of multiple changes in pattern and rates of substitution . Mol Phylogenet Evol . 2006 ; 38 : 100 ± 116 . https://doi.org/10.1016/j.ympev. 2005 . 09 .012 PMID: 16290034 36. Talavera G , Vila R , Igea J , Castresana J , Nakano H , Poustka A , et al. What is the phylogenetic signal limit from mitogenomes? The reconciliation between mitochondrial and nuclear data in the Insecta class phylogeny . BMC Evol Biol. BioMed Central ; 2011 ; 11 : 315 . https://doi.org/10.1186/ 1471 -2148-11-315 PMID: 22032248 37. Mans BJ , de Klerk D , Pienaar R , de Castro MH , Latif AA . Next-generation sequencing as means to retrieve tick systematic markers, with the focus on Nuttalliella namaqua (Ixodoidea: Nuttalliellidae) . Ticks Tick Borne Dis . 2015 ; 6 : 450 ± 462 . https://doi.org/10.1016/j.ttbdis. 2015 . 03 .013 PMID: 25936274 38. Barker SC , Murrell A . Systematics and evolution of ticks with a list of valid genus and species names . Ticks: Biology, Disease and Control . 2008 . pp. 1 ± 39 . https://doi.org/10.1017/CBO9780511551802.002 39. Klompen J. Systematics and Biogeography of Hard Ticks, a Total Evidence Approach . Cladistics. 2000 ; 16 : 70 ± 102 . https://doi.org/10.1006/clad. 1999 .0126 40. Dobson SJ , Barker SC . Phylogeny of the hard ticks (Ixodidae) inferred from 18S rRNA indicates that the genus Aponomma is paraphyletic . Mol Phylogenet Evol . 1999 ; 11 : 288 ± 295 . https://doi.org/10.1006/ mpev. 1998 .0565 PMID: 10191073 41. Mans BJ , de Klerk D , Pienaar R , Latif AA . Nuttalliella namaqua: A living fossil and closest relative to the ancestral tick lineage: Implications for the evolution of blood-feeding in ticks . PLoS One . 2011 ; 6 . https://doi.org/10.1371/journal.pone. 0023675 PMID: 21858204 42. Barker SC , Walker AR . Ticks of Australia. The species that infest domestic animals and humans . Zootaxa . 2014 ; 3816 : 1± 144 . https://doi.org/10.11646/zootaxa. 3816.1.1 PMID: 24943801 43. Zhang D , Zou H , Wu SG , Li M , Jakovlić I , Zhang J , et al. Sequencing, characterization and phylogenomics of the complete mitochondrial genome of Dactylogyrus lamellatus (Monogenea: Dactylogyridae) . J Helminthol . 2017 ; 1 ± 12 . https://doi.org/10.1017/S0022149X17000578 PMID: 28660842 44. Sanger F , Nicklen S , Coulson AR . DNA sequencing with chain-terminating inhibitors . Proc Natl Acad Sci . 1977 ; 74 : 5463 ± 5467 . https://doi.org/10.1073/pnas.74.12.5463 PMID: 271968 45. Altschul SF , Madden TL , SchaÈffer AA , Zhang J , Zhang Z , Miller W , et al. Gapped BLAST and PSIBLAST: A new generation of protein database search programs . Nucleic Acids Res . 1997 ; 25 : 3389 ± 3402 . https://doi.org/10.1093/nar/25.17.3389 PMID: 9254694 46. Burland TG . DNASTAR's Lasergene sequence analysis software . In: Misener S, Krawetz SA , editors. Methods in Molecular BiologyTM . Totowa, NJ: Humana Press; 2000 . pp. 71 ± 91 . https://doi.org/10. 1385/1-59259-192-2: 71 47. Hazkani-Covo E , Zeller RM , Martin W. Molecular poltergeists: Mitochondrial DNA copies (numts) in sequenced nuclear genomes . PLoS Genet . 2010 ; 6: e1000834 . https://doi.org/10.1371/journal.pgen. 1000834 PMID: 20168995 48. Schattner P , Brooks AN , Lowe TM . The tRNAscan-SE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs . Nucleic Acids Res . 2005 ; 33 : W686 ±9. https://doi.org/10.1093/nar/ gki366 PMID: 15980563 49. Laslett D , CanbaÈck B. ARWEN : A program to detect tRNA genes in metazoan mitochondrial nucleotide sequences . Bioinformatics . 2008 ; 24 : 172 ± 175 . https://doi.org/10.1093/bioinformatics/btm573 PMID: 18033792 50. Zhang D. MitoTool [Internet]. [cited 26 Jun 2017 ]. Available: https://github.com/dongzhang0725/ BioSuite 51. O 'Leary NA , Wright MW , Brister JR , Ciufo S , Haddad D , McVeigh R , et al. Reference sequence (RefSeq) database at NCBI: Current status, taxonomic expansion, and functional annotation . Nucleic Acids Res . 2016 ; 44 : D733±D745 . https://doi.org/10.1093/nar/gkv1189 PMID: 26553804 52. Li W , Cowley A , Uludag M , Gur T , McWilliam H , Squizzato S , et al. The EMBL-EBI bioinformatics web and programmatic tools framework . Nucleic Acids Res . 2015 ; 43 : W580±W584 . https://doi.org/10.1093/ nar/gkv279 PMID: 25845596 53. Lavrov D V , Boore JL , Brown WM . The complete mitochondrial DNA sequence of the horseshoe crab Limulus polyphemus . Mol Biol Evol . 2000 ; 17 : 813 ± 824 . https://doi.org/10.1093/oxfordjournals.molbev. a026360 PMID: 10779542 54. Katoh K , Standley DM . MAFFT multiple sequence alignment software version 7: Improvements in performance and usability . Mol Biol Evol . 2013 ; 30 : 772 ± 780 . https://doi.org/10.1093/molbev/mst010 PMID: 23329690 55. Zhang D. Biosuite [Internet]. [cited 26 Jun 2017 ]. Available: https://github.com/dongzhang0725/ BioSuite 56. Katoh K , Toh H . Improved accuracy of multiple ncRNA alignment by incorporating structural information into a MAFFT-based framework . BMC Bioinformatics . 2008 ; 9 : 212 . https://doi.org/10.1186/ 1471 -2105- 9-212 PMID: 18439255 57. Talavera G , Castresana J . Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments . Syst Biol . 2007 ; 56 : 564 ± 577 . https://doi.org/10. 1080/10635150701472164 PMID: 17654362 58. Castresana J . Selection of Conserved Blocks from Multiple Alignments for Their Use in Phylogenetic Analysis . Mol Biol Evol . 2000 ; 17 : 540 ± 552 . https://doi.org/10.1093/oxfordjournals.molbev. a026334 PMID: 10742046 59. Kalyaanamoorthy S , Minh BQ , Wong TKF , Von Haeseler A , Jermiin LS . ModelFinder: Fast model selection for accurate phylogenetic estimates . Nat Methods . 2017 ; 14 : 587 ± 589 . https://doi.org/10.1038/ nmeth.4285 PMID: 28481363 60. Trifinopoulos J , Nguyen LT , von Haeseler A , Minh BQ . W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis . Nucleic Acids Res . 2016 ; 44 : W232±W235 . https://doi.org/10.1093/nar/ gkw256 PMID: 27084950 61. Morgan CC , Foster PG , Webb AE , Pisani D , McInerney JO , O'Connell MJ . Heterogeneous models place the root of the placental mammal phylogeny . Mol Biol Evol . 2013 ; 30 : 2145 ± 2156 . https://doi.org/ 10.1093/molbev/mst117 PMID: 23813979 62. Lartillot N , Philippe H. Computing Bayes factors using thermodynamic integration . Syst Biol . 2006 ; 55 : 195 ± 207 . https://doi.org/10.1080/10635150500433722 PMID: 16522570 63. Miller MA , Pfeiffer W , Schwartz T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees . 2010 Gateway Computing Environments Workshop , GCE 2010 . 2010 . https://doi.org/10. 1109/GCE. 2010 .5676129 64. Maddock ST , Briscoe AG , Wilkinson M , Waeschenbach A , San Mauro D, Day JJ , et al. Next-generation mitogenomics: A comparison of approaches applied to caecilian amphibian phylogeny . PLoS One . 2016 ; 11 : e0156757. https://doi.org/10.1371/journal.pone. 0156757 PMID: 27280454 65. Silvestro D , Michalak I. RaxmlGUI: A graphical front-end for RAxML . Org Divers Evol . 2012 ; 12 : 335 ± 337 . https://doi.org/10.1007/s13127-011-0056-0 66. Stamatakis A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies . Bioinformatics . 2014 ; 30 : 1312 ± 1313 . https://doi.org/10.1093/bioinformatics/btu033 PMID: 24451623 67. Letunic I , Bork P . Interactive Tree Of Life (iTOL): An online tool for phylogenetic tree display and annotation . Bioinformatics . 2007 ; 23 : 127 ± 128 . https://doi.org/10.1093/bioinformatics/btl529 PMID: 17050570


This is a preview of a remote PDF: http://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0197524&type=printable

Zhi-Qiang Liu, Yan-Feng Liu, Nuer Kuermanali, Deng-Feng Wang, Shi-Jun Chen, Hui-Ling Guo, Li Zhao, Jun-Wei Wang, Tao Han, Yuan-Zhi Wang, Jie Wang, Chen-Feng Shen, Zhuang-Zhi Zhang, Chuang-Fu Chen. Sequencing of complete mitochondrial genomes confirms synonymization of Hyalomma asiaticum asiaticum and kozlovi, and advances phylogenetic hypotheses for the Ixodidae, PLOS ONE, 2018, DOI: 10.1371/journal.pone.0197524