Advanced search    

Search: Expression recombinant HBD3 protein reduces Emphasis Type

The page you are looking for is no longer available: Expression of recombinant HBD3 protein that reduces <Emphasis Type=. Showing search results instead.

1,108,818 papers found. Showing first 1,000 results.
Use AND, OR, NOT, +word, -word, "long phrase", (parentheses) to fine-tune your search.

Expression of recombinant HBD3 protein that reduces <Emphasis Type=

reagent. However, its minimal inhibitory concentration to M. bovis is not yet reported. In this study, we first purified HBD3 protein by recombinant-DNA technology and prokaryotic expression system ... best choice for rHBD3 protein expression. Subsequently, GST-HBD3 was expressed and proved no effects to host bacteria growth (Si et  al. 2007) . However, the recombinant protein was not perfectly

<Emphasis Type=

× 109 vs. < 30 × 109/L), karyotype classifications (favorable vs. intermediate vs. poor), H19 expression (low vs. high), and gene mutations (mutant vs. wild-type). The multivariate analysis included ... downstream gene ID2 in AML As is well-known, lncRNAs function directly or indirectly through the protein-encoding gene. A previous study showed that H19 was positively associated with ID2 expression in

<Emphasis Type=

at DNA level by CADMA and SNaPshot while IDH1 mutations in FFPE samples were analyzed at protein level by two IHC methods. CADMA PCR sensitivity for IDH1 was 96.4% and specificity 100% for 86 concluded ... staining or regional heterogeneity of mIDH1-R132H protein expression is present and in these cases the confirmatory genetic testing may be necessary [ 23, 29 ]. We restrain from final conclusion about

Safety of <Emphasis Type=

Pseudomonas species have a history of safe use in agriculture and certain species represent a source of genes with insecticidal properties. The ipd072Aa gene from P. chlororaphis encodes the IPD072Aa protein ... effects. Establishing a history of safe use, and a lack of known allergenic, toxic or pathogenic properties, contributes to the weight of evidence that a gene, and its expression product (protein), derived

<Emphasis Type=

; SPECT/MRI; NEP inhibition; Tumor imaging Introduction The gastrin-releasing peptide receptor (GRPR) is a G-protein coupled receptor overexpressed in a number of cancer types such as prostate cancer ... , patient-derived cell line with high GRPR expression. Xenografts were generated by subcutaneous implantation of the PC295 human prostate tumor as previously described and were stored at − 80 °C until further

Epigenetic modifications in <Emphasis Type=

methylation surrounding the transcriptional start site (TSS) has been investigated extensively [ 27 ]; generally, hyper-methylation blocks transcription initiation and reduces gene expression [ 27, 28 ... , 1.16-1.50, P = 1.1 × 10−4; HRcg26662347 = 1.88, 95%CI, 1.37-2.60, P = 3.7 × 10−3), and correlated with corresponding gene expression (cg11637544 for KDM2A, P = 1.3 × 10−10; cg26662347 for KDM1A P = 1.5

Improvement of <Emphasis Type=

avoid the drawbacks of growth disturbance due to disruption of ArgF, strategies were adopted to attenuate its expression. Firstly, ribosome binding site substitution and start codon replacement were ... transcription process, which is known to be crucial for protein expression (Nakamura et al. 2015). In this study, a C. glutamicum S9114 mutant strain, with deletion of ncgl1221, lysE, putP, and argR, was

Effects of <Emphasis Type=

leaves when significant amounts of proteins are leached (Benner et al. 1990) . The tannin-protein complexes are recalcitrant against microbial degradation and may therefore serve as a long-term source of ... activities over a longer period. In a follow-up study, it may be better to determine the expression of genes and not merely their presence, and when possible more frequently in time. A non-intended outcome

<Emphasis Type=

, protein , and enzyme activity in postmortem human brain . Am J Hum Genet 75 : 807 - 821 . https://doi. org/10.1086/425589 36. Meyer-Lindenberg A , Nichols T , Callicott H , Ding J , Kolachana B , Buckholtz ... cortex . Neuropsychopharmacology 39 ( 13 ): 3067 - 3076 . https://doi. org/10.1038/npp. 2014 .160 41. Akbarian S , Huang HS ( 2006 ) Molecular and cellular mechanisms of altered GAD1/GAD67 expression in

<Emphasis Type=

income (maysir)24 Maysir is a broader term and encompasses gambling, including but not limited to games of chance. The reason why Shariah law prohibits maysir type of income is that it is a randomly ... to do so at a significantly reduced price which consequently reduces the fees paid by consumers. A good example of the above is a UK P2P money transfer service provider, the fees of which are

Deciphering the trophic interaction between <Emphasis Type=

transcriptional response (RNA-seq). Mucin degradation by A. muciniphila supported the growth of A. caccae and concomitant butyrate production predominantly via the acetyl-CoA pathway. Differential expression ... possesses a total of 2176 predicted protein-coding sequences (CDSs) (van Passel et al. 2011) of which 2137 (98%) were found to be expressed in this study (Table S3). Differential expression analysis (DESeq2

Effect of <Emphasis Type=

containing protein gene (LOC_Os04g52590), (http://rice.plantbiology.msu.edu/cgi-bin/gbrowse/rice/ #search). Primers for qRT-PCR expression analysis were: 5′GGTGTTTGGTGTGATGTTGATG3′ and 5 ... differential expression of these two potential candidate genes along with a third neutral gene coding for retrotransposon protein (LOC_Os04g52540) in all the 12 QTL-NILs developed in the present study

<Emphasis Type=

their viability. The most common approach when one tries to accomplish this task is to first propose an f (R) expression at the level of the Lagrangian, with the requirement that it satisfies some priors ... differential equation in H [ 75 ], the expansion rate function which is generally needed in order to calculate cosmological distances, and we might miss an easy analytical expression for it (see [ 76 ] for

Response of <Emphasis Type=

stress conditions. As a non-protein agent, they protect cells from oxidative-damages by scavenging ROS (quenching mechanism) and removing toxic substances from the cell environment (Shohael et al. 2006 ... factor sensed by photoreceptors, induce gene expression and cell components biosynthesis in morphogenesis process (Arena et al. 2016) . Short wavelengths (between 380 and 450  nm) activate the

<Emphasis Type=

their relationship to classical categories of Varroa -specific hygienic behavior, uncapping (CO, BR, MR) and removing (BR, MR), their expression showed a dependency on the number of mites introduced. Five ... %) and removal (70.3%). These findings suggest that there is higher expression of Varroa -specific hygienic behavior in Apis mellifera scutellata as compared to Africanized bees and strain of honey bees of

<Emphasis Type=

of some of the vector states, with special emphasis on the single production of heavy gluons. Finally in Sect. 8 we summarise the overall picture. 2 The composite model defined The model is defined ... ±icγoμnvχe±ni(efnotutroidentify the Higgs current operators JμH = i H † ←D→μ H, JμH,a = i H †σ a ←D→μ H and we also need the approximate expression at leading order in 1/ f of the d and e symbols √2 dμi = − f

Cloning and expression of a novel α-1,3-arabinofuranosidase from <Emphasis Type=

-arabinofuranosidase gene (poabf62a) belonging to glycoside hydrolase family 62 from Penicillium oxalicum sp. 68 and expressed it in Pichia pastoris. The molecular mass of recombinant PoAbf62A was estimated to be 32.9 ... MG874674, respectively. Results Cloning, expression and purification of recombinant PoAbf62A The protein sequence of PoAbf62A from P. oxalicum (gene bank accession code EPS32936.1) predicted by Liu et

Transcriptome profiling of <Emphasis Type=

expression or the physiology of I. orientalis under ethanol stress. In this study, high-throughput RNA sequencing was used to investigate the transcriptome profile of I. orientalis in response to ethanol. 502 ... family are up-regulated during ethanol stress (Alexandre et al. 2001) . In contrast, little is known about gene and protein expression in I. orientalis under environmental stress. In this study, RNA-Seq

Genotyping of <Emphasis Type=

) . Recently, it was recommended that nine protein sequences should be used, in addition to the rRNA genes, to precisely classify newly discovered members of Chlamydiales at the family, genus and species levels ... expression (MNE) of 16S and 18S rRNA from Cand. S. salmonis and P. perurans during the culture period. Samples from all time points after the start of the co-cultures were taken as triplicates. Histology and

Placental surface area mediates the association between <Emphasis Type=

receptor 2 (FGFR2) gene encodes a protein of the fibroblast growth factor receptor family. FGFR2 gene expression is associated with the regulation of implantation process of placenta which plays a vital role ... associated with increased susceptibility to chronic non-communicable diseases in adulthood, such as type 2 diabetes, obesity, hypertension, stroke, and cardiovascular diseases [ 4–10 ]. LBW is the result of