Advanced search    

Search: authors:"Senjie Lin"

23 papers found.
Use AND, OR, NOT, +word, -word, "long phrase", (parentheses) to fine-tune your search.

Utilization of urea and expression profiles of related genes in the dinoflagellate Prorocentrum donghaiense

the manuscript. Author Contributions Conceptualization: Senjie Lin, Zhigang Yu. Data curation: Xiaoli Jing, Claudia Koerting, Zhigang Yu. Formal analysis: Xiaoli Jing. Funding acquisition: Senjie ... Lin. Investigation: Senjie Lin. Methodology: Xiaoli Jing, Senjie Lin, Huan Zhang, Claudia Koerting. Project administration: Senjie Lin, Zhigang Yu. Writing ± original draft: Xiaoli Jing. Writing

Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate

Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P) nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata...

An Improved DNA Extraction Method for Efficient and Quantitative Recovery of Phytoplankton Diversity in Natural Assemblages

demonstrate that our method is useful for DNA extraction of phytoplankton and environmental surveys of their diversity and abundance. - Competing Interests: The co-author Senjie Lin is an Academic Editor of

Light-Promoted Rhodopsin Expression and Starvation Survival in the Marine Dinoflagellate Oxyrrhis marina

The discovery of microbial rhodopsins in marine proteobacteria changed the dogma that photosynthesis is the only pathway to use the solar energy for biological utilization in the marine environment. Although homologs of these rhodopsins have been identified in dinoflagellates, the diversity of the encoding genes and their physiological roles remain unexplored. As an initial step...

Screening for Suitable Reference Genes for Quantitative Real-Time PCR in Heterosigma akashiwo (Raphidophyceae)

. - Competing Interests: The co-author Senjie Lin is an Academic Editor of PLOS ONE, but this does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials. Harmful algal blooms

Fukuyoa paulensis gen. et sp. nov., a New Genus for the Globular Species of the Dinoflagellate Gambierdiscus (Dinophyceae)

The marine epiphytic dinoflagellate Gambierdiscus is a toxicologically important genus responsible for ciguatera fish poisoning, the principal cause of non-bacterial illness associated with fish consumption. The genus currently contains species exhibiting either globular or anterior-posteriorly compressed morphologies with marked differences in cell shape and plate arrangement...

Tandem Repeats, High Copy Number and Remarkable Diel Expression Rhythm of Form II RuBisCO in Prorocentrum donghaiense (Dinophyceae)

41176091. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: Please note that the co-author Dr. Senjie Lin is

Molecular analysis of in situ diets of coral reef copepods: evidence of terrestrial plant detritus as a food source in Sanya Bay, China

Knowledge of copepod in situ diet is critical for accurate assessment of trophic linkages and transfer efficiencies of the marine food web but is limited due to technical challenges. Here we report, using a recently developed eukaryote-universal copepod-excluding ectobiotic ciliate-blocking protocol, to investigate the natural diets of the copepods Temora turbinata, Subeucalanus...

Apical Groove Type and Molecular Phylogeny Suggests Reclassification of Cochlodinium geminatum as Polykrikos geminatum

preparation of manuscript. Competing Interests: Co-corresponding author Senjie Lin is a PLOS ONE Editorial Board member. This does not alter the authors adherence to all the PLOS ONE policies on sharing data

Detecting In Situ Copepod Diet Diversity Using Molecular Technique: Development of a Copepod/Symbiotic Ciliate-Excluding Eukaryote-Inclusive PCR Protocol

Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its...

Distinct Gene Number-Genome Size Relationships for Eukaryotes and Non-Eukaryotes: Gene Content Estimation for Dinoflagellate Genomes

The ability to predict gene content is highly desirable for characterization of not-yet sequenced genomes like those of dinoflagellates. Using data from completely sequenced and annotated genomes from phylogenetically diverse lineages, we investigated the relationship between gene content and genome size using regression analyses. Distinct relationships between log10-transformed...

Retrieval of Missing Spliced Leader in Dinoflagellates

Spliced leader (SL) trans-splicing has recently been shown to be a common mRNA processing mechanism in dinoflagellates, in which a short (22-nt) sequence, DCCGUAGCCAUUUUGGCUCAAG (D = U, A, or G), is transplanted from the 5′-end of a small non-coding RNA (SL RNA) to the 5′ end of mRNA molecules. The widespread existence of the mechanism in dinoflagellates has been demonstrated by...

Nuclear, Mitochondrial and Plastid Gene Phylogenies of Dinophysis miles (Dinophyceae): Evidence of Variable Types of Chloroplasts

The Dinophysis genus is an ecologically and evolutionarily important group of marine dinoflagellates, yet their molecular phylogenetic positions and ecological characteristics such as trophic modes remain poorly understood. Here, a population of Dinophysis miles var. indica was sampled from South China Sea in March 2010. Nuclear ribosomal RNA gene (rDNA) SSU, ITS1-5.8S-ITS2 and...

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of...

Massive Gene Transfer and Extensive RNA Editing of a Symbiotic Dinoflagellate Plastid Genome

Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8–3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine...

Prevalent Ciliate Symbiosis on Copepods: High Genetic Diversity and Wide Distribution Detected Using Small Subunit Ribosomal RNA Gene

Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA)-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10...

Serious Overestimation in Quantitative PCR by Circular (Supercoiled) Plasmid Standard: Microalgal pcna as the Model Gene

Quantitative real-time PCR (qPCR) has become a gold standard for the quantification of nucleic acids and microorganism abundances, in which plasmid DNA carrying the target genes are most commonly used as the standard. A recent study showed that supercoiled circular confirmation of DNA appeared to suppress PCR amplification. However, to what extent to which different structural...

Dinoflagellate Spliced Leader RNA Genes Display a Variety of Sequences and Genomic Arrangements

Spliced leader (SL) trans-splicing is a common mRNA processing mechanism in dinoflagellates, in which a 22-nt sequence is transferred from the 5′-end of a small noncoding RNA, the SL RNA, to the 5′-end of mRNA molecules. Although the SL RNA gene was shown initially to be organized as tandem repeats with transcripts of 50–60 nt, shorter than most of their counterparts in other...

Spliced Leader RNAs, Mitochondrial Gene Frameshifts and Multi-Protein Phylogeny Expand Support for the Genus Perkinsus as a Unique Group of Alveolates

The genus Perkinsus occupies a precarious phylogenetic position. To gain a better understanding of the relationship between perkinsids, dinoflagellates and other alveolates, we analyzed the nuclear-encoded spliced-leader (SL) RNA and mitochondrial genes, intron prevalence, and multi-protein phylogenies. In contrast to the canonical 22-nt SL found in dinoflagellates (DinoSL), P...