Sodium selenite inhibits deoxynivalenol-induced injury in GPX1-knockdown porcine splenic lymphocytes in culture

Scientific Reports, Dec 2018

Deoxynivalenol (DON) is a cytotoxic mycotoxin that can cause cell damages. The main effect is to inhibit protein synthesis. Oxidative stress is one of the effects of DON. Selenium (Se) can ameliorate the cell damage caused by DON-induced oxidative stress, but it is unclear whether through selenoprotein glutathione peroxidase 1 (GPX1). We established GPX1-knockdown porcine spleen lymphocytes, and treated them with DON and Se. Untransfected porcine splenic lymphocytes (group P) and transfected cells (group M, GPX1 knockdown) were treated with or without DON (0.824, 0.412, 0.206, or 0.103 μg/mL, group D1-4), Se (Na2SeO3, 2 μM, group Se), or both (group SD1–4) for 6, 12, or 24 h. The cells were collected and the activities of SOD and CAT, levels of GSH, H2O2, malonaldehyde (MDA), total antioxidant capacity (T-AOC), and the inhibition of free hydroxyl radicals were determined. Levels of ROS were measured at 24 h. Compared with group P, the antioxidant capacity of group M was reduced. DON caused greater oxidative damage to the GPX1-knockdown porcine splenic lymphocytes than to the normal control cells. When Na2SeO3 was combined with DON, it reduced the damage in the GPX1-knockdown porcine splenic lymphocytes, but less effectively than in the normal porcine splenic lymphocytes.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

https://www.nature.com/articles/s41598-018-36149-x.pdf

Sodium selenite inhibits deoxynivalenol-induced injury in GPX1-knockdown porcine splenic lymphocytes in culture

Sodium selenite inhibits deoxynivalenol-induced injury in GPX1-knockdown porcine splenic lymphocytes in culture Zhihua Ren Yu Fan Zhuo Zhang Chaoxi Chen Changhao Chen Xuemei Wang Junliang Deng Guangneng Peng Yanchun Hu Suizhong Cao ShuminYu Xiaoping Ma Liuhong Shen Zhijun Zhong Ziyao Zhou Zhiwen Xu Zhicai Zuo OPEN Published: xx xx xxxx Deoxynivalenol (DON) is a cytotoxic mycotoxin that can cause cell damages. The main effect is to inhibit protein synthesis. Oxidative stress is one of the effects of DON. Selenium (Se) can ameliorate the cell damage caused by DON-induced oxidative stress, but it is unclear whether through selenoprotein glutathione peroxidase 1 (GPX1). We established GPX1-knockdown porcine spleen lymphocytes, and treated them with DON and Se. Untransfected porcine splenic lymphocytes (group P) and transfected cells (group M, GPX1 knockdown) were treated with or without DON (0.824, 0.412, 0.206, or 0.103?g/mL, group D1-4), Se (Na2SeO3, 2 ?M, group Se), or both (group SD1-4) for 6, 12, or 24h. The cells were collected and the activities of SOD and CAT, levels of GSH, H2O2, malonaldehyde (MDA), total antioxidant capacity (T-AOC), and the inhibition of free hydroxyl radicals were determined. Levels of ROS were measured at 24 h. Compared with group P, the antioxidant capacity of group M was reduced. DON caused greater oxidative damage to the GPX1-knockdown porcine splenic lymphocytes than to the normal control cells. When Na2SeO3 was combined with DON, it reduced the damage in the GPX1-knockdown porcine splenic lymphocytes, but less effectively than in the normal porcine splenic lymphocytes. - GPX1 was the first antioxidant enzyme shown to reduce H2O2 in red blood cells via GSH19. It is the most important antioxidant enzyme in the body and is widely expressed during major cell division. It can remove free radicals and peroxide from cells, and together with other antioxidant enzymes (catalase [CAT] and superoxide dismutase [SOD]), constitutes the endogenous antioxidant defence system20,21. An appropriate increase in GPX1 expression can enhance the antioxidant capacity of cells22,23. Our laboratory has shown that Se can reduce the damage to porcine spleen lymphocytes caused by DON-induced oxidative stress19, and can prevent the concomitant changes in cytokines induced in porcine spleen lymphocytes24. However, it remains unclear whether it antagonizes DON toxicity through the selenoprotein GPX1. In this study, we established GPX1-knockdown porcine spleen lymphocytes and treated them sodium selenite (Na2SeO3) and DON, singly or combined, in a culture system. We then measured the intracellular antioxidant index and the ROS content of the GPX1-knockdown porcine spleen lymphocytes to determine the protective effects of sodium selenite on DON-induced oxidative damage in these cells and whether Se acts through the selenoprotein GPX1 in antagonizing the toxicity of DON. MDA (nmol/mg.prot) Results Transfection efficiency of GPX1-directed small interfering RNA (siRNA) in porcine spleen lym phocytes. The transfection efficiency of GPX1-directed siRNA in porcine spleen lymphocytes is shown in Fig.?1. Transfection efficiency of GPX1-directed siRNA in porcine splenic lymphocytes. the blank control shown in A. In B, C, D, E shown the different transfection efficiency of combination. Combination E has the best transfection effect, we selected combination E for the subsequent experiment. Expression of GPX1 mRNA after siRNA transfection. The relative expression of GPX1 mRNA after siRNA transfection is shown in Table?1. The expression of GPX1 in the group of cells treated with the control GPX1-directed siRNA was 28.4% of that in the control group, This suggests that there was nonspecific gene knockdown. Expression of GPX1 protein in porcine spleen lymphocytes after siRNA transfection. The expression of the GPX1 protein in porcine spleen lymphocytes after siRNA transfection is shown in Fig.?2. That GPX1-knockdown cells expressed only 36.9% of the GPX1 expressed by the normal group. Therefore, the knockdown efficiency was 63.1%. Antioxidant indices and ROS levels. The activities of SOD and CAT, the levels of GSH, hydrogen peroxide (H2O2), and malonaldehyde (MDA), the total antioxidant capacity (T-AOC), and the ability to inhibit free hydroxyl radicals are shown in Tables?2?8. The activities of SOD and CAT and the ability to inhibit free hydroxyl radicals were significantly lower in group M than in group P at most time points (P < 0.01); the level of GSH was significantly lower in group M than in group P at each time point, except at 6 h; and the levels of H2O2 and MDA were significantly higher in group M than in group P at each time point. Treatment with DON (0.824?0.103 ?g/mL) alone reduced the activities of SOD and CAT, the levels of GSH and T-AOC, and the ability to inhibit free hydroxyl radicals significantly more strongly in group M than in the groups D1?4 at most time points; and the levels of H2O2 and MDA were significantly higher in the groups D1?4 than in group M. Treatment with Na2SeO3 (2 ?mol/L) alone significantly increased the activities of SOD and CAT, T-AOC, and free hydroxyl radical SOD activities(U/mg.prot) inhibition relative to those in group M, except for GSH at 6 h. The levels of H2O2 and MDA were significantly lower in the groups D1?4 than in group M. When the lymphocytes were treated with both DON and Na2SeO3, the activities of SOD and CAT, the levels of GSH and T-AOC, and the inhibition of free hydroxyl radicals were significantly higher in group SD1?4 than in group D1?4 at most time points. The rates of change in SOD, CAT, GSH, H2O2, MDA, T-AOC, and the inhibition of free hydroxyl radicals are shown in Tables?9?15. Except in a few cases, most KG-An(the rates of change in the GPX1-knockdown porcine splenic lymphocytes with knockdown group An) are less than NG-An(the change rates of our early achievements were normal group An). The levels of ROS are shown in Table?16. The level of ROS was lowest in group P, whereas group D1 had the highest ROS content. The ROS content was significantly higher in group M than in group P. The ROS content was significantly higher in groups D1?4 than in group M, except for group D4. The ROS content was significantly lower in group Se than that in group M. When the cells were treated with both DON and Na2SeO3, the ROS content was significantly lower in the groups SD1?4 than in the groups D1?4, except for group SD1. Discussion Oxidative stress occurs when the concentration of ROS exceeds the antioxidant capacity of the cell. When cells cultured in vitro are subjected to oxidative stress, they are mainly protected by the enzymes of their own antioxidant system, predominantly SOD, CAT, and GPX. GPX1 is the main GPX in spleen lymphocytes, and plays an important role in protecting the cells against oxidative stress. Using GSH as its substrate, GPX1 participates in the reduction of toxic peroxides, promotes the decomposition of H2O2, and thus protects the cell membrane. Yan25 knocked down the expression of GPX1 in ATDC5 cells with small hairpin RNA (shRNA), and found that the antioxidant capacity of the cells decreased. Our results are similar insofar as after GPX1 expression was reduced, the H2O2 content in group M increased as the incubation time increased, relative to that in group P, even at the beginning of silence that the SOD and CAT might compensate. The MDA and ROS content of group M was significantly higher than that of group P throughout the whole experiment (P < 0.01), whereas the GSH, SOD and CAT activities, T-AOC, and the capacity of the cells to inhibit hydroxyl radicals were significantly lower in group M. After GPX1 expression was knocked down in the porcine splenic lymphocytes, the antioxidant capacity of the cells decreased compared with that in group P, and the oxidative stress in the cells caused them more damage. 6 h 12 h 24 h CAT activities(U/mgprot) time pairing The presence of large amounts of lipids in cells makes them highly susceptible to peroxide and the damage caused by oxidative stress. The many lipid peroxidation products generated also have a toxic effect on the cells, causing further damage. The cellular levels of important lipid peroxidation products, including MDA, indicate the degree of lipid peroxidation and the amounts of free oxygen radicals in the cells, and can be used to indirectly determine the degree of oxidative damage to them26. When Kouadio et al.27 added 5?40 ?M DON to the Caco-2 cell line, there was a significant increase in the MDA content after 24h. Li28 also showed a significant increase in the MDA content after adding 100?2000 ng/mL DON to a chicken embryo fibroblasts (DF-1 cells) for 6?48h. In the present study, the content of MDA in the GPX1-knockdown porcine splenic lymphocytes increased as the DON concentration and the culture period increased. Therefore, our results are similar to those of the studies described above. We compared the results of this experiment with the results of our experiment with prophase cells19. After treatment with DON, the MDA content in the GPX1-knockdown porcine splenic lymphocytes was significantly higher than in the normal porcine splenic lymphocytes, indicating that lipid peroxidation increased in the cells after GPX1 knockdown. After the addition of DON, the content of H2O2 was significantly higher in the GPX1-knockdown porcine splenic lymphocytes than in the normal porcine splenic lymphocytes because GPX1 decomposes H2O2 and thus reduces DON-induced oxidative stress. T-AOC reflects the overall antioxidant capacity of the cells and is a comprehensive indicator of the cells antioxidant system. In this study, the T-AOC of the GPX1-knockdown porcine splenic lymphocytes decreased as the DON concentration and the incubation time increased, and was significantly lower than that in the normal porcine splenic lymphocytes treated with the same concentrations of DON for the same culture periods (P < 0.01). The results of this study are similar to those of Hao et al.29. who added AFB1 to lymphocytes from the spleens of pigs in which GPX1 was knocked down. Therefore, DON causes the levels of MDA and H2O2 to increase and the cellular T-AOC to decrease more severely in GPX1-knockdown porcine splenic lymphocytes than in control cells. Our results also show that, compared with the normal porcine splenic lymphocytes, the capacity of the GPX1-knockdown cells to inhibit hydroxyl radicals decreased more dramatically as the DON concentration increased and the incubation time increased, resulting in a greater accumulation of free radicals, a greater degree of oxidative stress, a greater reduction in T-AOC, and therefore more-severe oxidative damage. 6 h 12 h 24 h GSH (umol/gprot) Oxidative damage occurs when the intracellular reactive oxygen concentration exceeds the cell?s antioxidant capacity. ROS mainly include superoxide anions (?O2?), H2O2, and the hydroxyl radical (?OH). Cells scavenge ROS through both enzymatic and non-enzymatic pathways. The enzymatic pathways consist of antioxidant enzymes such as SOD, CAT, and GPX, and the non-enzymatic pathways involve GSH, Se, vitamin C, vitamin E, and ?-carotene30. SOD uses the superoxide anion (?O2?) produced in cells as its substrate, producing reduced SOD (SOD?) and O2, and then SOD? reacts with ?O2? to produce SOD and H2O2. H2O2 is then catalysed by CAT and GPX to generate H2O and O231, thus protecting the cell membrane from damage. CAT is a terminal oxidase that catalyses the decomposition of H2O2 into H2O and O2. GSH is a co-substrate of GPX, which catalyses it to GSSG, thus reducing a toxic peroxide to a nontoxic hydroxyl compounds, and at the same time promoting the decomposition of H2O2. This protects the cell membrane structure and function are safe from the oxide interference and damage. Studies have shown that at lower GSH contents can result in decreased GPx1 activity32. Therefore, after reactive oxygen is produced in cells, SOD acts as the first line of defence and CAT and GPX as the second line of defence, acting together in the process of scavenging intracellular reactive oxygen. Our results show that DON caused the activities of SOD and CAT to increase, and reduced the levels of GSH as the DON concentration and incubation time increased, demonstrating the time and concentration dependence of its effects. The results of this study are similar to those of Gan et al.33, who showed that when the expression of the GPX1 protein was knocked down, the GSH content of the cells decreased significantly after ochratoxins (OTA) were added. When the results of the present study were compared with the results of our study of prophase cells19, the SOD and CAT activities and the levels of GSH were significantly lower in the GPX1-knockdown porcine splenic lymphocytes when same concentrations of DON were added and the cells were cultured for the same time. This may be because the cells themselves had a lower antioxidant capacity after GPX1 knockdown, and the intracellular accumulation of ROS and the consumption of antioxidant enzymes and GSH were increased by the cytotoxicity of DON and DON-induced oxidative stress. Selenium is a necessary trace element in the diet of mammals because it plays an important role in many organ systems and life activities. The antioxidant effects of Se have always been a research hotspot, and it mainly occurs in selenocysteine and selenomethionine in selenoproteins, where it plays its antioxidant role. GPX is the T-AOC (U/mg.prot) main selenium antioxidant enzyme in cells34. GPX has at least four isoenzymes, and GPX1 is the most strongly expressed GPX in porcine splenic lymphocytes, where it plays an important role in ameliorating oxidative stress. In this study, after knocking down GPX1 expression, we added Na2SeO3 to the group M cells, and showed that the levels of MDA and H2O2 are significantly lower, and the activities of SOD and CAT, the levels of GSH and T-AOC, and the capacity to inhibit hydroxyl radicals were significantly higher than group M. These results are similar to the results of Tang35, who showed that Na2SeO3 had an antagonistic effect on GPX1-knockdown-induced oxidative damage to porcine splenic lymphocytes. A large number of studies have shown that Se prevents the oxidative stress induced by some mycotoxins36?38. In this study, the levels of MDA and H2O2 were significantly lower in the groups SD1?4 than in the groups D1?4 (P < 0.05 or P < 0.01), and the activities of SOD and CAT, the levels of GSH, T-AOC, and the capacity of the cells to inhibit hydroxyl radicals were higher in the groups SD1?4 than in the groups D1?4 mostly (P < 0.05 or P < 0.01). The rates of these changes in GPX1 knockdown porcine splenic lymphocytes were greater than in the normal porcine splenic lymphocytes, note the elevated ratio of the activities of SOD and CAT, the levels of GSH, T-AOC and the capacity of cells to inhibit hydroxyl radicals, the reduced ratio of the levels of MDA and H2O2 of GPx1 knockdown porcine splenic lymphocytes are lower than porcine splenic lymphocytes. These data indicate that the protective effects of Na2SeO3 against DON-induced oxidative damage were reduced by GPX1 knockdown. In summary, our results demonstrate that the knockdown the GPX1 in porcine splenic lymphocytes reduces their anti-oxidative capacity, and the cells? own oxidative stress causes them more damage than is caused in normal cells?. DON caused greater oxidative damage in GPX1-knockdown porcine splenic lymphocytes than in normal control cells. When combined with DON, Na2SeO3 ameliorated the DON-induced oxidative damage to GPX1-knockdown porcine splenic lymphocytes, but its protective effects were less marked than in normal cells. In the future, we will overexpress the GPX1 gene to in-depth study its effects, or to study spleen lymphocyte organelles. These studies are required to understand the molecular mechanisms underlying these phenomena. Our results also suggest that improved nutrition may be a novel approach to mitigating mycotoxin contamination in animal production. Materials and Methods Reagents. Foetal bovine serum was purchased from Gibco/Life Technologies (California, USA). Na2SeO3 powder was purchased from Xiya Reagent (Chengdu, China). DON was obtained from Sigma-Aldrich (USA). RPMI-1640 medium was obtained from Boster Biological Technology Co., Ltd (Wuhan, China). Hank?s solution and lymphocyte separation medium were obtained from Tianjin Hao Yang Biological Institute (China). Kits for testing glutathione(GSH), malonaldehyde (MDA), total antioxidant capacity (T-AOC), glutathione peroxidase (GPx), superoxide dismutase (SOD), catalase (CAT), hydrogen peroxide (H2O2), Hydroxyl Free Radical, were obtained from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The Reactive Oxygen Species Assay Kit was obtained from Beyotime Biotechnology (Shanghai, China). TRIzol Reagent was purchased from Groups KG-A1 NG-A1 KG-A2 NG-A2 KG-A3 NG-A3 KG-A4 NG-A4 Groups KG-A1 NG-A1 KG-A2 NG-A2 KG-A3 NG-A3 KG-A4 NG-A4 Groups KG-A1 NG-A1 KG-A2 NG-A2 KG-A3 NG-A3 KG-A4 NG-A4 Groups KG-A1 NG-A1 KG-A2 NG-A2 KG-A3 NG-A3 KG-A4 NG-A4 1 0 Groups KG-A1 NG-A1 KG-A2 NG-A2 KG-A3 NG-A3 KG-A4 NG-A4 Invitrogen Biotechnology Co., Ltd (Shanghai, China). PrimeScript? RT Reagent Kit and SYBR? Premix Ex Taq? II were purchased from Takara (Shiga, Japan). The anti-GPX1 primary antibody (ab50427) and the rabbit antigoat IgG H& L secondary antibody (ab6741) were from abcam. Production and treatment of porcine splenic lymphocytes and the establishment of GPX1-knockdown porcine spleen lymphocytes. For a description of the production of the porcine spleen lymphocytes, refer to our earlier paper24. All study procedures were approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University. All experiments were performed in accordance with relevant guidelines and regulations. Based on a published sequence of porcine GPX1 mRNA (GenBank NM-214201.0), siRNA was designed using Block-iTTM siRNA RNAi Designer (Thermo Fisher Scientific). The sequence with the highest score was selected, which had the control siRNA sequence 5?-GGGACUACACCCAGAUGAATT-3?. The scrambled siRNA was synthesized by Thermo Fisher Scientific, with the sequence 5?-UUCGUAUCUGGGUGUACCCTT-3?. The control siRNA sequence was confirmed to be consistent with that reported by Gan et al.33. The FAM fluorescent marker was added to the siRNA as required. RFectPM small nucleotide transfection agents was used for the transfection. To determine the optimal concentration of siRNA and transfection reagent, we tested four combinations, according to the reagent instructions. The specific information is shown in Table?17. The cells with the highest transfection efficiency were used for the subsequent experiments. The expression of GPX1 mRNA was detected with quantitative real-time PCR (qPCR) and the expression of GPX1 protein was detected 48 h after transfection with western blotting. The prepared porcine spleen lymphocytes and GPX1-knockdown lymphocytes were cultured in triplicate in six-well tissue culture plates at 3 ? 106 cells/mL. To determine the effects of DON and Se14,24, 11 groups of both types of cells were treated with medium only or with DON and/or Se in the following combinations: Group P (porcine splenic lymphocytes), group M (GPX1-knockdown porcine splenic lymphocytes), D1 (824 ng/mL DON), D2 (412 ng/mL DON), D3 (206 ng/mL DON), D4 (103 ng/mL DON), Se (2 ?mol/L Na2SeO3), SD1 (2 ?mol/L Na2SeO3 + 824 ng/mL DON), SD2 (2 ?mol/L Na2SeO3 + 412 ng/mL DON), SD3 (2 ?mol/L Na2SeO3 + 206 ng/mL DON), and SD4 (2 ?mol/L Na2SeO3 + 103 ng/mL DON). The cells were incubated for 6, 12, or 24 h. The concentration of DON and Se and the time of cells were incubated have been determined in the early stage of the laboratory. And the antioxidant indices were determined at each time point. The levels of ROS were detected at 24 h. Flow-cytometric determination of positive siRNA transfection efficiency. After transfection for 24 h, the cells were collected with centrifugation at 1800 r/min for 5 min at 4 ?C. The supernatant, was discarded and the cells were washed twice with phosphate-buffered saline (PBS) at 4 ?C. The PBS cell suspension (100?L) was precooled to 4 ?C and filtered through a 300 mesh filter. The cells were then analysed with flow cytometry. Reverse transcription (RT)?qPCR analysis of GPX1 mRNA expression after siRNA transfec tion. For a description of the RT?qPCR performed, see the paper by Wang26. The primer sequencing for GPx1: (F- TGGGGAGATCCTGAATTG, R- GATAAACTTGGGGTCGGT) ?-Actin was used as reference gence: (FCTGCGGCATCCACGAAACT, R- AGGGCCGTGATCTCCTTCTG). Detection of GPX1 protein with western blotting after transfection. The cells were washed twice with precooled PBS and suspended in 300 ?L of PBS. The cells were collected and homogenized on ice, and phenylmethanesulfonyl fluoride was added to the protein lysates. After 40 min on ice, the lysates were centrifuged at 12,000 rpm for 40 min at 4 ?C and the supernatants collected. The cellular protein was quantified with the BCA method using bovine serum albumin as the standard. Samples of protein (50 ?g) were diluted in sample loading buffer and heated at 95 ?C for 5 min. The denatured proteins were separated with 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred onto polyvinylidene difluoride membrane, and placed in closed liquid for 1 h at 37 ?C. The primary antibody was added and the membranes incubated at 4 ?C. At the same time, another membrane was incubated without antibody in Tris-buffered saline containing Tween 20 (TBS-T) as the negative control. After repeated washes, the membrane was incubated with a rabbit anti-goat IgG H&L secondary antibody with gentle shaking for 1 h at room temperature. After the membrane was washed, used western blot mark to observe, the absorbance (A) values were quantitatively analysed with an image analysis. Determination of antioxidant indices and levels of ROS. The antioxidant indices and the levels of ROS in the cell preparations (supernatants, cell lysates, and cells) were measured according to the protocols of the corresponding kits. Statistical analysis. The test results are expressed as means standard? deviations. Excel was used to preliminarily test and collate the results. The statistical software SPSS ver. 22 was used for later statistical analyses, and Duncan?s method was used for multiple comparisons. The rates of change in some antioxidant indices, including H2O2, MDA, SOD, CAT, GSH, T-AOC, and the inhibition of hydroxyl radicals, were calculated in the SD and Group D1?4s (as follows). To express the rates of change in the GPX1-knockdown porcine splenic lymphocytes with knockdown group An(KG-An), the change rates of our early achievements were normal group An(NG-An). The changes in the antioxidant indices after Na2SeO3 was added were calculated by comparing the absolute values of KG-An with NG-An, to determine whether Na2SeO3 was antagonistic to the porcine spleen lymphocyte by GPX1. An = (SD1 ? 4/D1 ? 4 ? 1) ? 100% (n = 4) Data Availability All data generated or analysed are valid during this study, included in this published article (and its Supplementary Information files). 1 2 Acknowledgements This study was supported by the National Natural Science Foundation of China (General Program, grant no. 31402269). We thank XG Du for his assistance with the experiments and to D Li for experimental material. We thank Janine Miller, PhD, from Liwen Bianji, Edanz Editing China (www.liwenbianji.cn/ac), for editing the English text of a draft of this manuscript. SCiEntifiC Author Contributions Z.H. Ren and Z.C. Zuo conceived the study. Y. Fan and Z. Zhang wrote the manuscript. C.X. Chen, X.M. Wang and Z.W. Xu conducted the real-time P.C.R. experiments, S.Z. Cao, X.P. Ma and L.H. Shen analysed the results, C.H. Chen and Y.C. Hu prepared the figures and tables, Z.Y. Zhou assisted with the RNA extractions. G.N. Peng, S.M. Yu, Z.J. Zhong and J.L. Deng conducted the western blotting experiments, and determined the antioxidant indices. All the authors have reviewed the manuscript. Competing Interests: The authors declare no competing interests. Publisher?s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article?s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article?s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. 1. Pronyk , C. , Cenkowski , S. & Abramson , D. Superheated steam reduction of deoxynivalenol in naturally contaminated wheat kernels . Food Control . 17 , 789 - 796 ( 2006 ). 2. Rotter , B. A. , Prelusky , D. B. & Pestka , J. J. Toxicology of deoxynivalenol (vomitoxin) . Journal of Toxicology and Environmental Health . 48 , 1 - 34 ( 1996 ). 3. Pestka , J. J. & Smolinski , A. T. Deoxynivalenol : Toxicology and potential effects on humans . Journal of Toxicology and Environmental Health. 8 , 39 ( 2005 ). 4. Zain , M. E. Impact of mycotoxins on humans and animals . Journal of Saudi Chemical Society . 15 , 129 - 144 ( 2011 ). 5. Shifrin , V. I. & Anderson , P. Trichothecenemycotoxins trigger a ribotoxic stress response that activates c-Jun N-terminal kinase and p38 mitogen-activated protein kinase and induces apoptosis . Journal of Biological Chemistry . 274 , 13985 - 13992 ( 1999 ). 6. Ueno , Y. et al. Comparative toxicology of trichothec mycotoxins: inhibition of protein synthesis in animal cells . Journal of Biological Chemistry . 74 , 285 - 296 ( 1973 ). 7. Islam , Z. , Gray , J. S. & Pestka , J. J. p38 mitogen-activated protein kinase mediates IL-8 induction by the ribotoxin deoxynivalenol in human monocytes . Toxicology and Applied Pharmacology . 213 , 235 - 244 ( 2006 ). 8. Pestka , J. J. Mechanisms of deoxynivalenol-Induced gene expression and apoptosis . Food Additives and Contaminants . 25 , 1128 - 1140 ( 2008 ). 9. Mishra , S. , Dwivedi , P. D. , Pandey , H. P. & Das , M. Role of oxidative stress in deoxynivalenol induced toxicity . Food and Chemical Toxicology . 72 , 20 - 29 ( 2014 ). 10. Ren , Z. H. et al. Combined effects of deoxynivalenol and zearalenone on oxidative injury and apoptosis in porcine splenic lymphocytes in vitro . Experimental and Toxicologic Pathology . 69 , 612 - 617 ( 2017 ). 11. Braca , A. , Sortino , C. , Politi , M. , Morelli , I. & Mendez , J. Antioxidant activity of flavonoids from licania licaniaeflora . Journal of Ethnopharmacology . 79 , 379 - 381 ( 2002 ). 12. Thomson , C. D. Assessment of requirements for selenium and adequacy of selenium status: a review . European Journal of Clinical Nutrition . 58 , 391 - 402 ( 2004 ). 13. Niedzielski , P. et al. Selenium species in selenium fortified dietary supplements . Food Chemistry . 190 , 454 - 459 ( 2016 ). 14. Ren , F. , Chen , X. , Hesketh , J. , Gan , F. & Huang , K. Selenium promotes T-cell response to TCR-stimulation and ConA, but not PHA in primary porcine splenocytes . Plos One . 7 , e35375 ( 2012 ). 15. Lin , C. G. et al. Effects of different selenium sources on growth performance, serum antioxidant capacity and plasma selenium content of weaned piglets . Chinese Journal of Animal and Veterinary Sciences . 44 , 1790 - 1796 ( 2013 ). 16. Rizzo , A. F. , Atroshi , F. , Ahotupa , M. , Sankari , S. & Elovaara , E. Protective effect of antioxidants against free radical-mediated lipid peroxidation induced by DON or T-2 toxin . Zentralbl Veterinarmed A. 41 , 81 - 90 ( 2010 ). 17. Peng , S. Q. et al. Toxic effects of deoxynovalenol on articular chondrocytes and the protective effect of Selenium . Chinese journal of Endemiology . 13 , 80 - 82 ( 1994 ). 18. Wang , X. et al. Protective role of selenium in the activities of antioxidant enzymes in piglet splenic lymphocytes exposed to deoxynivalenol . Environmental Toxicology and Pharmacology . 47 , 53 - 61 ( 2016 ). 19. Ma , S. Progress on GSH-Px and GST. Progress in Veterinary medicine . 29 , 53 - 56 ( 2008 ). 20. Miller , J. C. et al. Influence of the glutathione peroxidase 1 Pro200Leu polymorphism on the response of glutathione peroxidase activity to selenium supplementation: a randomized controlled trial . American Journal of Clinical Nutrition . 96 , 923 - 931 ( 2012 ). 21. Chen , F. et al. Association of glutathione peroxidase-1 gene polymorphism with kawasaki disease . Chinese journal of arteriosclerosis. 23 , 290 - 294 ( 2015 ). 22. Moriscot , C. , Richard , M. J. , Favrot , M. C. & Benhamou , P. Y. Protection of insulin-secreting INS-1 cells against oxidative stress through adenoviral-mediated glutathione peroxidase overexpression . Diabetes and Metabolism . 29 , 145 - 151 ( 2003 ). 23. Shao , S. et al. Effect of glutathione peroxidase 1 overexpression on DNA oxidative damage and phenotype of malignant BERP35T1 cells . Carcinogenesis Teratogenesis and Mutagenesis . 28 , 8 - 13 ( 2016 ). 24. Wang , X. M. et al. Protective role of selenium in immune-relevant cytokine and immunoglobulin production by piglet splenic lymphocytes exposed to deoxynivalenol . Biological Trace Element Research . 1- 9 ( 2017 ). 25. Yan , J. , Guo , Y. , Yao , F. , Zhang , R. & Han, Y. GPx1 knockdown suppresses chondrogenic differentiation of ATDC5 cells through induction of reductive stress . Acta Biochimica et Biophysica Sinica . 49 , 110 - 118 ( 2017 ). 26. Larsen , M. et al. Mannitol in cardioplegia as an oxygen free radical scavenger measured by malondialdehyde . Perfusion . 17 , 51 - 55 ( 2002 ). 27. Kouadio , J. H. et al. Comparative study of cytotoxicity and oxidative stress induced by deoxynivalenol, zearalenone or fumonisin B1 in human intestinal cell line Caco-2 . Toxicology. 213 , 56 - 65 ( 2005 ). 28. Li , D. et al. Evaluation of deoxynivalenol-induced toxic effects on DF-1 cells in vitro: cell-cycle arrest, oxidative stress, and apoptosis . Environmental Toxicology and Pharmacology . 37 , 141 - 149 ( 2014 ). 29. Hao , S. et al. Selenium alleviates Aflatoxin B1-induced immune toxicity through improving glutathione peroxidase 1 and selenoprotein S expression in primary porcine splenocytes . Journal of Agricultural and Food Chemistry . 64 , 1385 ( 2016 ). 30. Zhang , K. F. , Zhang , Z. P. , Chen , Y. , Lin , P. & Wang , Y. L. Antioxidant defense system in animals . Chinese journal of Zoology . 42 , 153 - 160 ( 2007 ). 31. Chen , H. P. & Tan , X. F. Literature review of researches on superoxide dismutase . Nonwood Forest Research . 25 , 59 - 65 ( 2007 ). 32. Dragomir-Bodea , G. O. et al. Influence of deoxynivalenol on the oxidative status of HepG2 cells . Romanian Biotechnological Letters . 14 , 4349 - 4359 ( 2009 ). 33. Gan , F. , Xue , H. , Huang , Y. , Pan , C. & Huang , K. Selenium alleviates porcine nephrotoxicity of ochratoxin A by improving selenoenzyme expression in vitro . Plos One . 10 , e0119808 ( 2015 ). 34. Xu , F. , Qiu , D. R. & Yang , P. Y. Chemical and biochemical speciation of Se proteins . Chemical world. 47 , 246 - 250 ( 2006 ). 35. Tang , R. , Liu, H. , Wang , T. & Huang , H. Mechanisms of selenium inhibition of cell apoptosis induced by oxysterols in rat vascular smooth muscle cells . Archives of Biochemistry and Biophysics . 441 , 16 - 24 ( 2005 ). 36. Fang , J. et al. The molecular mechanisms of protective role of Se on the G2/M phase arrest of jejunum caused by AFB1 . Biological Trace Element Research . 181 , 1 - 12 ( 2017 ). 37. Van-Le-Thanh , B. et al. The potential effects of antioxidant feed additives in mitigating the adverse effects of corn naturally contaminated with Fusarium mycotoxins on antioxidant systems in the intestinal mucosa, plasma, and liver in weaned pigs . Mycotoxin Research . 32 , 1 - 18 ( 2016 ). 38. Jie , Y. , Chen , D. W. & Bing , B. Protective effects of selenium and vitamin E on rats consuming maize naturally contaminated with mycotoxins . Frontiers of Agriculture in China. 3 , 95 - 99 ( 2009 ). Additional Information Supplementary information accompanies this paper at https://doi.org/10.1038/s41598-018-36149-x.


This is a preview of a remote PDF: https://www.nature.com/articles/s41598-018-36149-x.pdf

Zhihua Ren, Yu Fan, Zhuo Zhang, Chaoxi Chen, Changhao Chen, Xuemei Wang, Junliang Deng, Guangneng Peng, Yanchun Hu, Suizhong Cao, Shumin Yu, Xiaoping Ma, Liuhong Shen, Zhijun Zhong, Ziyao Zhou, Zhiwen Xu, Zhicai Zuo. Sodium selenite inhibits deoxynivalenol-induced injury in GPX1-knockdown porcine splenic lymphocytes in culture, Scientific Reports, DOI: 10.1038/s41598-018-36149-x