YCZ-18 Is a New Brassinosteroid Biosynthesis Inhibitor

PLOS ONE, Mar 2015

Plant hormone brassinosteroids (BRs) are a group of polyhydroxylated steroids that play critical roles in regulating broad aspects of plant growth and development. The structural diversity of BRs is generated by the action of several groups of P450s. Brassinazole is a specific inhibitor of C-22 hydroxylase (CYP90B1) in BR biosynthesis, and the application use of brassinazole has emerged as an effective way of complementing BR-deficient mutants to elucidate the functions of BRs. In this article, we report a new triazole-type BR biosynthesis inhibitor, YCZ-18. Quantitative analysis the endogenous levels of BRs in Arabidopsis indicated that YCZ-18 significantly decreased the BR contents in plant tissues. Assessment of the binding affinity of YCZ-18to purified recombinant CYP90D1 indicated that YCZ-18 induced a typical type II binding spectrum with a Kd value of approximately 0.79 μM. Analysis of the mechanisms underlying the dwarf phenotype associated with YCZ-18 treatment of Arabidopsis indicated that the chemically induced dwarf phenotype was caused by a failure of cell elongation. Moreover, dissecting the effect of YCZ-18 on the induction or down regulation of genes responsive to BRs indicated that YCZ-18 regulated the expression of genes responsible for BRs deficiency in Arabidopsis. These findings indicate that YCZ-18 is a potent BR biosynthesis inhibitor and has a new target site, C23-hydroxylation in BR biosynthesis. Application of YCZ-18 will be a good starting point for further elucidation of the detailed mechanism of BR biosynthesis and its regulation.

A PDF file should load here. If you do not see its contents the file may be temporarily unavailable at the journal website or you do not have a PDF plug-in installed and enabled in your browser.

Alternatively, you can download the file locally and open with any standalone PDF reader:

http://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0120812&type=printable

YCZ-18 Is a New Brassinosteroid Biosynthesis Inhibitor

March YCZ-18 Is a New Brassinosteroid Biosynthesis Inhibitor Data Availability Statement: All relevant data are within the paper. 0 1 2 Keimei Oh 0 1 2 Tadashi Matsumoto 0 1 2 Ayumi Yamagami 0 1 2 Atushi Ogawa 0 1 2 Kazuhiro Yamada 0 1 2 Ryuichiro Suzuki 0 1 2 Takayuki Sawada 0 1 2 Shozo Fujioka 0 1 2 Yuko Yoshizawa 0 1 2 Takeshi Nakano 0 1 2 0 1 Department of Biotechnology, Faculty of Bioresource Sciences, Akita Prefectural University , Shimoshinjo Nakano, Akita, Japan, 2 Antibiotics laboratory, RIKEN, 2-1 Hirosawa, Wako, Saitama , Japan , 3 Department of Bioproduction, Faculty of Bioresource Sciences, Akita Prefectural University , Shimoshinjo Nakano, Akita , Japan , 4 Biotechnology Research Center, Faculty of Bioresource Sciences, Akita Prefectural University , Shimoshinjo Nakano, Akita , Japan , 5 RIKEN Center for Sustainable Resource Science , Wako, Saitama, Japan, 6 CREST , Japan Science and Technology Agency , Kawaguchi, Saitama , Japan 1 Funding: This study was supported in part by funding from the Akita Prefectural University President's Research Project to KO and the CREST, Japan Science and Technology Agency to TN. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript 2 Academic Editor: Miguel A Blazquez, Instituto de Biologia Molecular y Celular de Plantas , SPAIN Plant hormone brassinosteroids (BRs) are a group of polyhydroxylated steroids that play critical roles in regulating broad aspects of plant growth and development. The structural diversity of BRs is generated by the action of several groups of P450s. Brassinazole is a specific inhibitor of C-22 hydroxylase (CYP90B1) in BR biosynthesis, and the application use of brassinazole has emerged as an effective way of complementing BR-deficient mutants to elucidate the functions of BRs. In this article, we report a new triazole-type BR biosynthesis inhibitor, YCZ-18. Quantitative analysis the endogenous levels of BRs in Arabidopsis indicated that YCZ-18 significantly decreased the BR contents in plant tissues. Assessment of the binding affinity of YCZ-18 to purified recombinant CYP90D1 indicated that YCZ-18 induced a typical type II binding spectrum with a Kd value of approximately 0.79 M. Analysis of the mechanisms underlying the dwarf phenotype associated with YCZ-18 treatment of Arabidopsis indicated that the chemically induced dwarf phenotype was caused by a failure of cell elongation. Moreover, dissecting the effect of YCZ-18 on the induction or down regulation of genes responsive to BRs indicated that YCZ-18 regulated the expression of genes responsible for BRs deficiency in Arabidopsis. These findings indicate that YCZ-18 is a potent BR biosynthesis inhibitor and has a new target site, C23-hydroxylation in BR biosynthesis. Application of YCZ-18 will be a good starting point for further elucidation of the detailed mechanism of BR biosynthesis and its regulation. - Competing Interests: The authors have declared that no competing interests exist. determination [23]. Mutants with impaired BR synthesis display dramatic growth defects, such as decreased cell elongation, resulting in pleiotropic dwarf phenotypes, delayed flowering, and male sterility [47]. BRs also modulate plant metabolic pathways in response to environmental biotic and abiotic stress resistance, including tolerance of salt, drought and oxidative stresses and pathogen resistance [8, 9]. Because BRs are involved in controlling plant architecture, seed yields and stress resistance, manipulating BR levels in plant tissues is considered useful for enhancing crop production. The use of transgenic techniques to manipulate endogenous BR levels has a remarkable effect on plant growth. Overexpression of DWARF4, an enzyme that catalyzes a rate-limiting step in BR biosynthesis, enhances plant growth and seed yield in Arabidopsis thaliana (hereafter Arabidopsis) [10]. Similarly, transgenic rice plants overexpressing a sterol C-22 hydroxylase that catalyzes a key step in BR biosynthesis show increased biomass and seed yields [11], and available evidence indicates that mutations in BR biosynthesis may be a means to improve biomass production [12]. Consequently, the biosynthetic pathway of BRs is a potential target for engineering in terms of crop protection [13]. An alternative method for manipulating the BR levels in plant tissues is the use of specific inhibitors targeting the enzymes involved in BR biosynthesis. Because agrochemicals have been widely used for crop protection in the modern agricultural industry, this method has advantages over the use of BR-deficient mutants, as it can be used at different stages of plant growth and development [14]. Moreover, inhibitors can easily be applied to different plant species. In this context, the search for potent inhibitors of BR biosynthesis represents a worthwhile approach to develop new technologies for manipulating BR levels in plant tissues. The biosynthetic pathways of BRs were initially elucidated by tracer experiments using various labeled precursors of brassinolide (BL) in periwinkle (Catharanthus roseus) cell lines [15]. The pathways were later validated by analyzing the endogenous levels of BRs in BR-deficient mutants [4, 16]. With the combination of genetic and biochemical approaches, the entire metabolic pathway in the biosynthesis of BRs has been identified (Fig. 1) [17]. Molecular and functional analysis of the BR biosynthesis mutants demonstrated that BR biosynthesis was mediated by several cytochrome P450 monooxygenases (P450s). DWF4/CYP90B1 is thought to catalyze the C-22 hydroxylation of campesterol (CR) [16]. CPD/CYP90A1 is thought to be involved in the C-3 dehydrogenation of steroid skeletons [18]. CYP90C1/ROT3 and CYP90D1, which are genetically closely related, are shown to have redundant functions as C23 hydroxylases [19]. Arabidopsis CYP85A1 and CYP85A2 were found to catalyze the C-6 oxidation reaction [20]. These observations indicate that many steps in BR biosynthesis are catalyzed by P450 enzymes (Fig. 1). Therefore, it is reasonable to postulate that the biosynthetic pathway of BRs is an expedient target for P450 inhibitors. Likewise, the multiplicity of P450s in BR biosynthesis suggests the possibility of developing P450 inhibitors targeting different steps of BR biosynthesis, thereby allowing us to probe the detailed mechanism of BR biosynthesis and its regulation. The mechanisms of inhibition of P450 have been studied in considerable detail [21]. Triazole derivatives have been demonstrated to have widespread ability as P450 inhibitors due to the intrinsic affinity of the nitrogen electron pair in heterocyclic molecules for the prosthetic heme iron. The triazole derivatives thus bind not only to lipophilic regions of the protein but also simultaneously to the prosthetic heme iron [22]. Accordingly, the chemical structures beyond the triazole moiety in P450 inhibitors of the triazole type are of significant importance regarding the selectivity of P450 inhibition. Asami reported the discovery of brassinazole (chemical structure shown in Fig. 2), the first class of synthetic triazole-type inhibitors of BR biosynthesis [2325]. Studies on the modes of action of brassinazole have shown that the target site of brassinazole is DWF4 (CYP90B1) [26]. To explore new inhibitors with novel target sites in BR biosynthesis, we have been developing P450 inhibitors targeting BR biosynthesis [2730]. Using an approach based on ketoconazole as a molecular scaffold, we found a new series of inhibitors of BR biosynthesis (YCZ-series) [27]. Structure-activity relationship studies of YCZs revealed a highly selective and potent inhibitor: YCZ-18 (chemical structure shown in Fig. 2) [28, 29]. Stereochemical structure-activity relationship studies led to the identification of 2R,4S-YCZ-2013 and 2S,4R-YCZ-2013, analogues of YCZ-18, which are the most potent BR biosynthesis inhibitors found to date, with IC50 values of approximately 24 2 and 24 1 nM, respectively [30]. In the present work, we report a biochemical and physiological characterization of YCZ-18. Our results indicate that YCZ-18 is a specific BR biosynthesis inhibitor with a wide range of applicability for altering BR biosynthesis in Arabidopsis. Assessment of the target site of YCZ-18 indicates that one of its targets is CYP90D1, which differentiates YCZ-18 from brassinazole, a known BR biosynthesis inhibitor. Synthesis and purification of YCZ-18 were carried out according to a method described previously [27]. Teasterone (TE) and brassinolide (BL) were purchased from Brassino Co., Ltd. (Toyama, Japan). Cathasterone (CT) was provided by Professor Suguru Takatsuto of Joetsu University of Education. Brz 220 was a gift provided by Professor Tadao Asami of The University of Tokyo. Other reagents of the highest purity were purchased from Tokyo Chemical Industry Co., LTD. (Tokyo, Japan) or Wako Pure Chemical Industries, Ltd. (Tokyo, Japan). All the chemicals for biological studies, unless otherwise described, were dissolved in DMSO and stored at -30C before use. Plant materials and growth conditions Arabidopsis thaliana Columbia-0 (Col-0) was used in all the experiments. BR-deficient mutant de-etiolation2 (det2) [31] and Brz220, a potent BR biosynthesis inhibitor [23], were used as positive controls. Untreated plants were used as controls for comparison with the chemical-induced phenotype. Plants were germinated and grown on half-strength Murashige and Skoog (MS) medium containing 1.0% sucrose and 0.9% phyto-agar (Duchefa), in the presence or absence of inhibitors and/or BRs. Seed sterilization and seed handling were carried out as described previously [29]. Conditions in the growth chamber were 16 h light (100 E m-2 sec-1 white light)/8 h dark at 22C unless otherwise indicated. For gene expression analysis, ground tissue from whole seven-day-old seedlings was used. YCZ-18 treatment under soil and hydroponic culture conditions Soil: Seeds were sown in soil and grown in controlled environments (16/8 h light/dark cycle, 22C, 5060% relative humidity). Ten-day-old Arabidopsis plants were sprayed with an aqueous solution of YCZ-18 (5 M containing 0.1% DMSO, approximately 0.1 pmol/plant). Two days later, YCZ-18 was sprayed on plants in the same way for the second time, and the plants were allowed to continue to grow in soil for observations of chemical-induced phenotypes. Plants sprayed with an aqueous solution of DMSO were used as a control. Hydroponics: Sterilized seeds were sown on sponges (approximately 0.2 cm thick) saturated with half MS solution in 0.9% phyto-agar. The seeds were placed in a hydroponic culture system that was prepared as previously described [32]. Twenty-day-old plants were placed and grown in culture medium [32] with the indicated concentrations of YCZ-18 (0.1, 0.5, 1 M). Plants grown in culture medium without YCZ-18 were used as controls. Quantitative analysis of brassinosteroids To determine the endogenous levels of BRs, seedlings of Arabidopsis (wild type (control), YCZ18-treated (3M), Brz-treated (3M)) were harvested to yield approximately 15 g fresh weight tissues. The tissues were extracted twice with 250 ml of methanol. Deuterium-labeled internal standards (1.5 ng/g fresh weight) were added to the extracts. Purification and quantification of brassinosteroids were performed according to the methods described previously [33, 34]. Plants treated without or with YCZ-18 (1 M) were grown under hydroponic conditions in a growth chamber under standard conditions, as described above. The inflorescence stems from seven-week-old plants were dissected. The tissue was fixed in FAA for 16 h at 4C, dehydrated with a graded ethanol series, embedded in paraffin, sectioned longitudinally in 10-m slices using a microtome (Microm HM360, Microm, Laborgert GmbH, Walldorf, Germany) and dried at 37C. Paraffin was removed from the sections with xylene. The prepared slides were hydrated in an ethanol-water series and stained with hematoxylin. They were then dehydrated in a graded water-ethanol series, ethanol-xylene and then xylene. The slides were mounted with Eukitt and image data was captured under a microscope (BX51, Olympus, Japan). The cell length of pith in stem was calculated from the image data using Image J (Version 1.48, National Institute of Health, USA). The length of ten cells with three replications was measured in each treatments and the mean and standard deviation were calculated. Quantitative real-time PCR The methods for total RNA isolation, cDNA synthesis, and real-time PCR have been previously described [35]. The sequences of the gene-specific primers for real-time PCR were as follows: for TCH4, 5- CGAGTCTTTGGAACGCTGAT-3 and 5-CTTCTTGTTGAAAGCCACGG-3; for DWF4, 5-CATAAAGCTCTCTTCAGTCACGA-3 and 5-CGTCTGTTCTTTGTTTCCTAA3; for LHCP, 5-ATCCGACCGAGTCAAGTACT-3 and 5-GGTTCCTTGCGAATGTCT-3; and for rbcS, 5-GCACCGACTCCGCTCA-3 and 5-TGGACTTGACGGGTGTTGTC-3. Construction of CYP90D1 expression vectors Arabidopsis full-length cDNA was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan [36, 37]. The expression vector, pCold-GST, was obtained from Dr. C. Kojima of Osaka University [38]. The DNA fragment encoding CYP90D1 mature protein was generated by PCR with forward primer 5-AATCGAGCTCATGGACACTTCTTC TTCACTTTTG-3 and reverse primer 5- TTGACTGCAGTTATATTCTTTTGATCCAA ATGGGT-3. The PCR product was digested with SacI-PstI and was inserted into the pColdGST expression vector. All of the constructed plasmids were transferred to the BL21 star (DE3) strain of E. coli (Invitrogen). The transformed cell was incubated in 10 ml of Luria broth containing 100 l/ml of chloramphenicol overnight at 37C. The 10 ml of pre-culture was incubated in 1000 ml of Luria broth containing 100 l/ml of ampicillin at 37C. Expression and purification of recombinant CYP90D1 The expression and purification of recombinant CYP90D1 were performed as described previously [39]. The purified CYP90D1 was dialyzed for 6 h at 4C by using an oscillatory dialysis system (Daiichi Pure Chemicals, Co. Ltd. Tokyo, Japan) against 2x300 ml dialysis buffer (50 mM sodium phosphate buffer, pH 7.0). Cleavage of the fusion protein was carried out by using HRV3C protease according to the suppliers protocol (Takara, Bio., KK. Japan). Protein measurements were performed using a Protein Assay Kit (Bio-Rad, Hercules, CA, USA), using bovine serum albumin as a standard. The relative purity of recombinant CYP90D1 was estimated by SDSpolyacrylamide gel electrophoresis (12% polyacrylamide) and staining of gels with Coomassie Brilliant Blue R250. Binding assay of YCZ-18 to recombinant CYP90D1 Binding of YCZ-18 to CYP90D1 was measured by optical difference spectroscopy of purified recombinant CYP90D1 using a Shimadzu UV3100 spectrophotometer. Purified recombinant CYP90D1 was diluted in 50 mM sodium phosphate buffer (pH 7.0) with 0.1% Tween 20 to a final concentration of 3.5 M containing 20% glycerol and separated into two matched blackwalled quartz cuvettes (500 l). After establishing a baseline, 0.7 l of YCZ-18 (0.5 mM dissolved in Me2SO) was added to the sample cuvette. Equal volumes of Me2SO were added to the reference cuvette. The samples were allowed to equilibrate for 2 min, and the difference spectrum was determined between 370 and 500 nm. The final volume of additions was kept to <1% of the total volume. Changes in absorbance as a function of YCZ-18 concentration (0.7, 1, 2, 4, 8, 12, 16 M) were determined at wavelengths selected on the basis of the spectral characteristics of each individual sample. Data obtained were used to calculate binding constants based on linear regression analysis. Spectral determinations were performed at least twice for each experiment, confirming the reproducibility with respect to the spectral profile and the position of max and min. All measurements were carried out at least in triplicate. Data analysis (t-test and analysis of variance) was applied to determine the significant difference with the use of significance throughout the manuscript being based upon P<0.05 unless stated otherwise. To elucidate the effects of YCZ-18 on the growth of Arabidopsis, three complementary growth conditions were assigned to ensure the capture of data describing the impact of YCZ-18 to Arabidopsis growth and development over the entire life of the plants. The first growth condition, growth on plates for a period of 12 weeks, demonstrates the effects of YCZ-18 on early seedling growth. The second condition is a hydroponic growth condition that has been validated for studies on root development. The third condition consists of spraying the chemicals on the plants grown in soil for a period of approximately 2 months. Fig. 3 shows the effects of YCZ-18 on Arabidopsis grown on plates. We treated wild-type Arabidopsis plants with YCZ-18 at concentrations ranging from 0.3 to 3 M for 5 days after their germination on half MS agar-solidified medium under light (Fig. 3B-G) and dark (Fig. 3A) conditions. BR-deficient mutant deetiolation2 (det2) [31] and wild-type Arabidopsis treated with Brz220 (3 M) [23] were used as positive controls for comparison with the experimental phenotype. The hypocotyl of Arabidopsis seedlings without chemical treatment elongated to approximately 18 mm with closed cotyledons in the dark condition (Fig. 3A). In contrast, the Arabidopsis wild-type plants in YCZ-18-containing medium exhibited short Fig 3. YCZ-18-treated plants display the BR-deficient phenotype. YCZ-18-treated plants (0.3, 1, 3 M), Brz220-treated plants (3 M) and brassinosteroid-deficient mutant (det2) plants were grown for 6 days in the dark (A) and for 10 days in the light (B-G) on medium containing the chemical indicated. The control plants (Cont) were untreated. Scale bar = 5 mm. hypocotyls and opened cotyledons, similar to the features of det2 mutant and wild-type plants treated with Brz220 (Fig. 3A). The hypocotyl elongation was suppressed by YCZ-18 in a dosedependent manner. To compare the overall efficacy of YCZ-18 with Brz220, we treated the plants with equal concentrations of inhibitors. Wild-type Arabidopsis plants treated with 3 M YCZ-18 displayed an approximately 90% reduction of hypocotyl length (Fig. 3A, third plant from the right), whereas those treated with Brz220 (3 M) showed an approximately 80% reduction in hypocotyl length (Fig. 3A, second plant from the right). The degree of suppression of the hypocotyl elongation for Brz220 (3 M) was similar to that treated with 0.3 M YCZ-18 (Fig. 3A, the second plant from the left). In the light condition, YCZ-18 significantly reduced the rosette diameter (the plant size) of wild-type plants of Arabidopsis (Fig. 3E-G), to no larger than half the size of control plants (Fig. 3B). At a concentration of 0.3 M YCZ-18 (Fig. 3E), YCZ-18 reduced plant size to a greater degree than det2 (Fig. 3D) or 3 M Brz220 treatment (Fig. 3C). The plants grown on the half MS agar-solidified medium containing YCZ-18 showed dark green leaves, a common characteristic of BR-deficient mutants and Brz220-treated plants [23, 31]. In some cases, studies of plant root development are challenging. To evaluate the effect of YCZ-18 on the growth of Arabidopsis under hydroponic conditions, a hydroponic system developed by Tocquin P. et al. was used in the present work [32]. We treated the twenty-day-old plants with YCZ-18 at final concentrations of 0.1, 0.5 and 1 M in the culture medium. The rosette diameter of the plants was used as a factor to evaluate the chemically induced dwarfism of Arabidopsis. In untreated plants, the rosette diameter increased as a function of time (Fig. 4E, blue diamond). In the presence of YCZ-18, the growth rate decreased with the increasing concentrations of YCZ-18 (Fig. 4E). The rosette diameters for forty-five-day-old Arabidopsis without YCZ-18 treatment were approximately 7.30.5 cm (Fig. 4A). In the presence of YCZ-18 Fig 4. Effect of YCA-18 on the hydroponic growth of Arabidopsis. Arabidopsis plants grown under hydroponic conditions with or without YCZ-18 treatment were treated as indicated in the methods section. Forty-five-day-old Arabidopsis (A); forty-five-day-old Arabidopsis treated with YCZ-18 at 0.1 M (B), 0.5 M (C), or 1 M (D). The growth curves of Arabidopsis treated with different concentrations of YCZ-18 (E). Data are the means s.e. obtained from 8 to 10 plants. Bar = 1 cm. (0.1 M), the rosette diameters were approximately 5.90.2 cm (Fig. 4B). The rosette diameters of plants in the presence of YCZ-18 at final concentrations of 0.5 and 1 M were found to be approximately 3.50.2 (Fig. 4C) and 2.10.2 cm (Fig. 4D), respectively. These results indicate that YCZ-18 induces dwarfism of Arabidopsis under hydroponic conditions (p<0.05). To further evaluate the biological activities of YCZ-18 in Arabidopsis, we next examined the effects of YCZ-18 on Arabidopsis grown in soil. The application of YCZ-18 on wild-type Arabidopsis was conducted by spraying an aqueous solution of YCZ-18 (5 M) on the tenday-old wild-type Arabidopsis (approximately 0.2 pmol/plant), as described in the methods section. The rosette diameter of four-week-old Arabidopsis treated with YCZ-18 was approximately 1.20.1 cm (Fig. 5B), which was smaller than that of the control (approximately 8.50.5 cm, Fig. 5A). This result suggests that YCZ-18 significantly induced dwarfism in Arabidopsis. After the plants had grown in soil for another 2 weeks, the plants without Fig 5. Effect of YCZ-18 on the growth of Arabidopsis in soil. The application of YCZ-18 on wild-type Arabidopsis was performed by spraying an aqueous solution of YCZ-18 (5 M) onto ten-day-old wild-type Arabidopsis plants (approximately 0.2 pmol/plant), as indicated in the methods section. Four-week-old Arabidopsis seedlings (A), four-week-old Arabidopsis treated with YCZ-18 (B), six-week-old Arabidopsis (C), six-week-old Arabidopsis seedlings treated with YCZ-18 (D), rosette leaf number of six-week-old Arabidopsis at bolting from three plants (E). Data are the means s.e. obtained from 3 plants. Scale bar = 1 cm. YCZ-18 treatment grew to the reproductive stage (Fig. 5C), whereas the YCZ-18-treated plants remained in the vegetative stage (Fig. 5D). The number of rosette leaves of YCZ-18treated plants averaged approximately 33.6 1.0 (leaves), whereas the control plants had 14.31.0 leaves (Fig. 5E). This result indicates that YCZ-18 prolonged the vegetative stage YCZ-18 reduces endogenous BR levels different from Brz. To further investigate the action mechanism of YCZ-18 on BR biosynthesis, we determined the endogenous levels of BRs in YCZ-18-treated Arabidopsis. Using gas chromatography-mass spectrometry (GC-MS) analysis together with deuterium-labeled BRs as internal standards [33, 34], we found that YCZ-18 significantly decreased the endogenous BR levels in Arabidopsis (Table 1). In non-treated plants, the amount of castasterone, which is the adjacent precursor of brassinolide, was found approximately 0.19 ng/g fw, while the amount of castasterone was observed approximately 0.03 ng/g fw in YCZ-18-treated Arabidopsis (Table 1). This result indicated that YCZ-18 significantly reduced the endogenous BR levels in Arabidopsis. Interestingly, the pattern of the levels of individual BR in YCZ-18-treated Arabidopsis was quite different from that of positive control Brz-treated Arabidopsis. As shown in Table 1, Brz decreased all the detectable BR at a level below 0.1 ng/g fw, but YCZ-18 did not. The amount *nd: not detected (below detection limit) of 3-dehydro-6-deoxoteasterone, for example, was observed slightly increased in YCZ-18treated Arabidopsis by the comparison with non-treated control (0.47 versus 0.35 ng/g fw.) (Table 1). This result indicates that YCZ-18 has a different mode of action from Brz. The short stature and the reduction in growth rate of YCZ-18-treated Arabidopsis could be due to a reduction in cell expansion or elongation. To gain insight into the mechanisms underlying the morphological changes associated with YCZ-18 treatment, we performed a histological analysis of inflorescence stems of Arabidopsis grown under hydroponic conditions. Our transverse stem sections indicate that the dwarfism of the morphological phenotypes is driven by a significant decrease in cell elongation (Fig. 6A, 6B). The average cell length of pith in YCZ-18treated (1 M) plants was statistically (p<0.001) shorter than that of the control plants (76.0 0.6 versus 203.4 7.2 m). Therefore, the short stature and reduced tissue/organ size seen in YCZ-18-treated plants are largely or exclusively due to a failure of individual cell elongation. YCZ-18 regulated the expression of BR-responsive genes To further investigate the mechanism of YCZ-18 action in Arabidopsis at the molecular level, we assessed the effects of YCZ-18 on BR-responsive gene expression. Seven-day-old wild-type plants of Arabidopsis grown on half MS agar-solidified media treated with or without YCZ-18 were used for quantitative real-time PCR (qPCR) analysis. The concentrations of YCZ-18 used were 0.3, 1, and 3 M, concentrations at which YCZ-18 promisingly induces BR-deficiency-like phenotypes in Arabidopsis (Fig. 2). As shown in Fig. 7, the BR-positive regulatory gene THC4, which encodes xyloglucan endotransglycosylase [40], showed lower expression, and the BR biosynthetic gene DWF4 encoding CYP90B1, which is downregulated with BR stimulation through a feedback mechanism [41], showed higher expression in wild-type Arabidopsis grown on YCZ18 than in plants grown on the control medium without YCZ-18 in the light (Fig. 7A, B). Fig 6. Longitudinal sections of YCZ-18 treated and untreated plant tissues. Stem from a seven-week-old control plant grown under hydroponic conditions. Average cell length of pith is 203.4 12.5 m (A). Stem from a seven-week-old YCZ-18-treated (1 M) plant. Average cell length is 76.0 1.0 m (B). Arabidopsis plants were grown as shown in Fig. 4(A) And (B) are at the same magnification; Bar = 150 m. BR-deficient mutant det2 and wild-type plants treated with brassinazole showed increased expression of photosynthesis genes in the dark, which is a phenomenon known as de-etiolation in the dark by BR-deficiency [25, 31, 42]. In general, the photosynthesis genes, rbcS, encoding the small subunit of ribulose 1,5-diphosphate carboxylase [43], and LHCP, encoding light-harvesting chlorophyll a/b-binding proteins [44], are used as genetic markers for light and BR-deficiency responses [25, 31]. As shown in Fig. 7C and 7D, under dark conditions, the expression levels of these two photosynthesis genes were higher in wild-type Arabidopsis treated with YCZ-18 than those without YCZ-18 treatment. In addition, the positive control of Brz220-treated wild-type Arabidopsis and the BR-deficient mutant det2 display similar patterns in the up- and downregulation of the expression of these genes (Fig. 7). Fig 7. YCZ-18 regulates the expression of BR-responsive genes. Quantitative RT-PCR experiment measuring the relative expression levels of a BRupregulated gene (TCH4) (A), a BR biosynthetic gene (DWF4) (B) and two photosynthesis genes (LHCP (C) and rbcS (D)) of the wild-type plant (Cont), YCZ18-treated (0.3, 1, 3 M), Brz-treated (3 M) and brassinosteroid-deficient mutant det2. Plants were grown for 10 days in the light (A, B) and for 6 days in the dark (C, D) on a medium containing the chemical indicated. All results are means s.e. YCZ-induced short hypocotyls were rescued by the brassinosteroid biosynthesis intermediate teasterone but not by cathasterone We have previously shown that YCZ-18-induced short hypocotyls of dark-grown Arabidopsis seedlings can be restored by the application of teasterone (TE) but not by campestanol (CN) (Fig. 1) [29]. With this observation, the candidate target site of YCZ-18 in BR biosynthesis has been narrowed down to the following two steps. One step is the C-22 hydroxylation of CN (or 6-oxoCN) to 6-deoxocathasterone (6-deoxoCT) (or CT), which is catalyzed by CYP90B1 (DWF4) [16]. The second step is the C-23 hydroxylation of 6-deoxoCT (or CT) to 6-deoxoTE (or TE), which is catalyzed by CYP90C1/ROT3 and/or CYP90D1, two closely related enzymes with redundant functions (Fig. 1) [19]. To identify the target site of YCZ-18 between these two steps, we conducted a stepwise feeding experiment by using CT and TE to test whether CT could rescue the YCZ-induced dwarfism of Arabidopsis seedlings grown in the dark. As shown in Fig. 8, in the presence of 0.5 M YCZ-18, the hypocotyl length of Arabidopsis seedlings was approximately 2.60.4 mm, whereas the hypocotyl length of the controls was approximately 13.80.5 mm. When TE (10 M) was added to the growth medium, the hypocotyl length of Arabidopsis seedlings was restored from 3.60.3 to 13.20.5 mm. This result indicates that TE reversed the YCZ-18-induced dwarfism of Arabidopsis seedlings grown in the dark, implying that the enzymes downstream of TE were not inhibited by YCZ-18. Application of CT (30 M) did not reverse the YCZ-18-induced dwarfism as the hypocotyl length shifted from 3.60.3 to 4.20.2 mm, suggesting that YCZ-18 inhibited enzymes downstream of CT. Taking these results together with our previous observations [29], the target site of YCZ-18 in BR biosynthesis is the C-23 hydroxylation of CT, which is performed by CYP90C1 and CYP90D1. YCZ-18 binds to CYP90D1 To characterize the binding target responsible for YCZ-18 activity in BR biosynthesis inhibition, we cloned the genes of CYP90C1 and CYP90D1 into the pCold-GST expression vector. Using an E. coli expression system, we attempted to purify these recombinant proteins. Despite substantial efforts to optimize the expression conditions of these genes, we could not obtain the purified recombinant CYP90C1 proteins but had poor expression in soluble fractions. However, we successfully expressed and purified CYP90D1. Thus, we determined the binding affinity of YCZ-18 to CYP90D1. Binding of YCZ-18 to CYP90D1 was determined by measuring optical difference spectra upon the addition of YCZ-18 to recombinant CYP90D1. CYP90D1 exhibited a Soret Fig 8. YCZ18-treated Arabidopsis in response to cathasterone (CT) and teasterone (TE). Five-day-old Arabidopsis seedlings (8A, 8E, white bar), treated with 0.5 M YCZ-18 (8B, 8E, yellow bar), treated with 0.5 M YCZ-18 together with 30 M cathasterone (CT) (8C, 8E, red bar), or treated with 0.5 M YCZ-18 together with 10 M teasterone (TE) (8D, 8E, blue bar). Data are the means s.e. obtained from 30 seedlings. Scale bar = 3 mm. absorption peak at 421 nm, which is characteristic of low-spin P450s (Fig. 9A, pink line). The addition of YCZ-18 to the CYP90D1 protein induced a type II absorbance shift of the heme Soret band from 421 to 425 nm (Fig. 9A, blue line). This is characteristic of the change from a low to a high spin state of the ferric iron that is usually associated with the direct coordination of the triazole group of the YCZ-18 to the heme iron of CYP90D1. The dissociation constant Kd was determined by titrating the observed spectral absorbance difference (A436-A416) versus the concentration of YCZ-18 (Fig. 9B). The double reciprocal plot for calculating Kd revealed that the dissociation constant for YCZ-18 was 0.79 m (Fig. 9C). In the present work, we used a variety of methods to investigate the mechanism of YCZ-18 action and presented evidence that YCZ-18 is a potent inhibitor of BR biosynthesis with a wide range of applicability to alter the BR levels in Arabidopsis. We used three culture methods and demonstrated that YCZ-18 induced BR-deficient-like dwarf phenotypes in Arabidopsis at low doses (Fig. 35). Using GC-MS analysis to determine the endogenous levels of YCZ-18-treated Arabidopsis provided definitive evidence that YCZ-18 caused the significant decrease in endogenous levels of BRs in Arabidopsis. Moreover, we found that the pattern of the endogenous levels of BRs in YCZ-18-treated Arabidopsis was different from Brz-treated Arabidopsis. This observation suggests that YCZ-18 has a different mode of action from that of Brz. To gain insight into the physiological and cellular mechanisms underlying the reduction in longitudinal growth associated with the YCZ-18 treatment, we performed a histological analysis. Our transverse stem sections indicated that the YCZ-18-induced morphological phenotypes were due to a significant reduction in cell elongation (Fig. 6A, 6B). This result is consistent with the previous observations from BR-deficient mutants and brassinazole-treated Arabidopsis [25, 31]. It has been reported that Arabidopsis BR biosynthetic mutants exhibit a prolonged vegetative phase and delayed flowering time. For example, the endogenous BR levels in det2 mutants are less than 10% of that in wild-type plants [31]: the mutants produced more than twice as many rosette leaves as wild-type Arabidopsis before flowering. Likewise, dwf4 also possessed a prolonged vegetative phase and produced approximately twice the number of rosette leaves as the wild type. The flowering time was delayed by approximately 4 days in dwf4 mutants [45]. These results indicated that altering the endogenous BR levels affected rosette leaf initiation in Arabidopsis. Data obtained in the present study indicate that the YCZ-18-treated plants produce more than twice as many rosette leaves as the untreated controls (Fig. 5E). Although the molecular mechanism underlying the biological action of YCZ-18 on promoting rosette leaf growth requires elucidation, our finding suggests that the biological activity of YCZ-18 on suppressing the Arabidopsis growth is effective for over two weeks. Moreover, YCZ-18 induced a dwarf phenotype of the hypocotyl and produced more rosette leaves in wild-type Arabidopsis than in plants without chemical treatment. Indeed, similar dwarf phenotypes could be observed not only in BR-deficient mutants but also in gibberellin (GA)-deficient mutants. To distinguish the primary site of action of YCZ-18 between BR biosynthesis and GA biosynthesis, we have previously shown that the dwarf phenotype of Arabidopsis seedlings induced with YCZ-18 in the dark could be rescued by the application of BR but not by GA [29]. Data obtained from the current study provided molecular confirmation through a qPCR analysis of BR-related marker genes. The expression of TCH4, which is induced by BR treatment, was downregulated by YCZ-18 treatment. Further, the expression of DWF4, which is a gene sensitively suppressed by BR treatment, was upregulated by YCZ-18 treatment (Fig. 7A, 7B). Importantly, in the case of the GA-deficient mutant ga15, the expression levels of TCH4 and DWF4 are not altered in comparison with Arabidopsis wild-type plants (http://bar.utoronto. Fig 9. Binding of YCZ-18 to CYP90D1. Absorption spectra of oxidized CYP90D1 (blue line) and its YCZ-18 complex (pink line). Recombinant CYP90D1 (3.5 M) was dissolved in 50 mM NaH2PO4 (pH 7.0) with 0.1% Tween 20 containing 20% glycerol, and YCZ-18 was added to CYP90D1 at a final concentration of 16 M (A). Spectrophotometric titration of CYP90D1 with YCZ-18 induced spectral changes in CYP90D1. YCZ-18 was added to CYP90D1 (3.5 M) at various final concentrations (a, 0.7; b, 1; c, 2; d, 4; e, 8; f, 12; g, 16 M) (B). The spectral dissociation constant was calculated from a double reciprocal plot of absorbance differences, A (436415 nm) versus the YCZ-18 concentrations given 0.79 m (C). The experiment was duplicated to establish reproducibility. ca/efp/cgi-bin/efpWeb.cgi). Thus, although the dwarf phenotype may be due to the deficiency of both BR- and GA-biosynthesis, combining our qPCR data with our previous observations [29], it is clear that YCZ-18 targets BR biosynthesis. Another line of evidence indicating that YCZ-18 is a potent and specific inhibitor of BR biosynthesis is obtained from the qPCR analysis of photosynthesis genes. We found that the expression of the photosynthesis genes rbcS and LHCP was upregulated by YCZ-18 in the darkgerminated wild-type Arabidopsis plants (Fig. 7C, D). YCZ-18 also induced promotion of greening in the light-grown plants (Fig. 2 and 3). It has been reported that the BR-deficient mutant det2 and brassinazole-treated Arabidopsis wild-type plants induced expression of photosynthesis genes both at the germination stage in the dark and at the promotion of leaf greening in the light-grown stage. The deficiency of BRs has been considered to be a unique phenomenon that could cause de-etiolation and the induction of photosynthesis gene expression in the dark [23, 31]. In case of max2, a F-box deficient mutant that was identified as a stay-green and late senescence mutant ore9 through mutant screening [46], the hypocotyl elongation of darkgerminated max2 mutant was found as long as Arabidopsis wild-type plant [47]. Similarly, the plant hormone cytokinin was also considered to have activity suppressing leaf senescence, thereby inhibiting hypocotyl elongation in Arabidopsis [48]. The mechanism of cytokinins inhibition of hypocotyl elongation in Arabidopsis is attributed to a secondary effect of ethylene, a plant hormone that promotes senescence, which can be produced by the action of cytokinin [49]. Considering these observations, data obtained in the present work indicate that induction of photosynthesis genes in the dark and the promotion of leaf greening in the light by YCZ-18 was largely or exclusively due to the primary action of YCZ-18 on inhibiting BR biosynthesis. To identify the target of YCZ-18 in BR biosynthesis, we conducted a feeding experiment involving the application of BR biosynthesis intermediates to YCZ-18-treated Arabidopsis, followed by the determination of the binding affinity of YCZ-18 to purified recombinant enzymes of interest. Feeding of cathasterone and teasterone to YCZ-18-treated Arabidopsis demonstrated that the probable target site for YCZ-18 in BR biosynthesis was the C-23 hydroxylation of cathasterone (Fig. 8). Binding studies of YCZ-18 to CYP90D1 provided evidence indicating that YCZ-18 induced a typical type II binding spectrum with a dissociation constant of approximately 0.79 M (Fig. 9). Genetic analysis of the C-23 hydroxylase mutants in BR biosynthesis indicated that CYP90C1 and CYP90D1 were two closely related genes with redundant functions as C-23 hydroxylases in BR biosynthesis [19, 50]. The disruption of CYP90C1 in the rot3 mutants results in a weak dwarf phenotype [51] but causes no appreciable alteration of the endogenous BR levels [50]. Further, CYP90D1 deficiency does not show any visible changes in Arabidopsis morphology [50]. In contrast, the double mutant for these P450 enzymes exhibits a severe dwarf phenotype [19, 50]. Because the soluble recombinant protein of CYP90C1 was poorly expressed in E. coli, the binding analysis for YCZ-18 and CYP90C1 could not be performed. However, based on the observations of the YCZ-18induced morphological changes in Arabidopsis seedlings, we anticipate that YCZ-18 blocks C-23 hydroxylation of BR biosynthesis, thereby interfering with both CYP90C1 and CYP90D1 (Fig. 1) because YCZ-18 can induce severe BR-deficient-like phenotypes in Arabidopsis at low doses (Fig. 36). Data obtained from binding analysis combined with the quantitative analysis gave definitive evidences that YCZ-18 is a new BR biosynthesis inhibitor. Binding analysis indicated that one of the primary site of action of YCZ-18 is the C23 hydroxylase. Additionally, the profiles of BR intermediates in YCZ-18 treated Arabidopsis is quite different from Brz treated plants (Table 1), Interestingly, we found the levels of 3-dehydro-6-deoxoteasterone in YCZ-18 treated Arabidopsis is almost in the same levels as that of control (Table 1), implying that YCZ-18 may also interfering the steps between 3-dehydro-6-deoxoteasterone and 6deoxocastasterone. Brassinazole has been identified as the first synthetic small-molecule compound targeting C-22 hydroxylase (DWF4) in BR biosynthesis (Fig. 1) [26]. Data obtained in this work provide evidence for the first time that YCZ-18 targets the C-23 hydroxylation of cathasterone in BR biosynthesis, causing remarkable effects on plant growth and development. Therefore, it is worthwhile to emphasize that the most important finding in this work is that the step of C-23 hydroxylation of BRs is an appropriately sensitive target for inhibitors. Moreover, because the YCZ-18 targeting step is different from brassinazole in BR biosynthesis, YCZ-18 is a new important molecular tool for elucidating the functions of BRs. Until now, brassinazole has been widely used for BR research, both for the elucidation of BR functions in plant physiology and for the identification of BR signal transduction components [52]. The use of chemical inhibitors in genetic screens provides an efficient way to identify novel mutants, which has emerged as a useful strategy to study biological systems in plants [14]. In the last century, mutagenesis strategies have played a central role in elucidating biological processes by investigating the relationships between genes and phenotypes, called classical genetics. Genetic approaches cause permanent, irreversible changes in the genetic and phenotypic make-up. The problems associated with classical genetics include genetic lethality, redundancy and tissue/development-specific expression. Because small molecules target proteins by modulating their functions, they can overcome the problems associated with classical genetics. Another advantage for small molecules over classical genetics is that they are easy to apply to different plant species and different stages of plant growth and development. In some cases, small molecules also provide selective inhibition of certain isoforms of an enzyme. For example, several small-molecule inhibitors of phosphoinositide 3-kinases were recently profiled. Their ability to inhibit specific kinase isoforms is useful for elucidating the respective roles of these isoforms in insulin signaling [53]. Small molecules are especially useful as general tools to elucidate various biological processes. As in the present work, YCZ-18 exhibits potent biological activity upon inducing BR-deficient-like phenotypes in Arabidopsis. In addition, YCZ-18 and brassinozole target different enzymes. Therefore, further experiments with YCZ-18 to explore the biological processes related to BRs may provide new insights into the detailed mechanism of BR biosynthesis and its regulation. We present three independent lines of evidence indicating that YCZ-18 is a potent inhibitor of BR biosynthesis with a wide range of applicability for altering BR levels in Arabidopsis. (1) Under three culture methods, YCZ-18 induces an Arabidopsis phenotype that is similar to that of BR-deficient mutants. (2) YCZ-18 regulates the expression of BR-responsive genes, which was shown in both BR-deficient mutants and brassinazole-treated plants. (3) Quantitative analysis on BR levels in YCZ-18 treated Arabidopsis indicated that YCZ-18 significantly decreased the endogenous levels of BRs. (4) YCZ-18 shows high binding affinity to recombinant CYP90D1 protein, suggesting that one of the primary sites of action of YCZ-18 is the C-23 hydroxylation of the side chain of BRs. Combining these results with our previously reported observations [28], we conclude that YCZ-18 is a potent BR biosynthesis inhibitor and has a new target site, C23-hydroxylation in BR biosynthesis. Acknowledgments We thank Professor Emeritus of Akita Prefectural University and Tokyo University Noboru Murofushi for his thoughtful suggestions on preparing this manuscript. We also thank Professor Jieyu Chen of Akita Prefectural University for his suggestions on statistical analysis. Conceived and designed the experiments: KO TN RS. Performed the experiments: KO SF TM AY AO. Analyzed the data: KO TN. Contributed reagents/materials/analysis tools: SF KY TS YY. Wrote the paper: KO TN. 1. Clouse SD , Sasse JM ( 1998 ) BRASSINOSTEROIDS: Essential regulators of plant growth and development . Annu Rev Plant Physiol Plant Mol Biol 49 : 427 - 451 . PMID: 15012241 2. Hartwig T , Chuck GS , Fujioka S , Klempien A , Weizbauer R , Potluri DP , et al. ( 2011 ) Brassinosteroid control of sex determination in maize . Proc Natl Acad Sci U S A 108 : 19814 - 19819 . doi: 10.1073/pnas. 1108359108 PMID: 22106275 3. Sasse JM ( 2003 ) physiological actions of brassinosteroids: an update . J Plant Growth Regul 22 : 276 - 288 . PMID: 14676971 4. Choe S , Dilkes BP , Gregory BD , Ross AS , Yuan H , Noguchi T , et al. ( 1999 ). The Arabidopsis dwarf1 mutant is defective in the conversion of 24-methylenecholesterol to campesterol in brassinosteroid biosynthesis . Plant Physiol 119 : 897 - 907 . PMID: 10069828 5. Hong Z , Ueguchi-Tanaka M , Umemura K , Uozu S , Fujioka S , Takatsuto S , et al. ( 2003 ) A rice brassinosteroid-deficient mutant, ebisu dwarf (d2), is caused by a loss of function of a new member of cytochrome P450 . Plant Cell 15 : 2900 - 2910 . PMID: 14615594 6. Bishop GJ , Nomura T , Yokota T , Harrison K , Noguchi T , Fujioka S , et al. ( 1999 ) The tomato DWARF enzyme catalyses C-6 oxidation in brassinosteroid biosynthesis . Proc Natl Acad Sci U S A 96 : 1761 - 1766 . PMID: 9990098 7. Nomura T , Nakayama M , Reid JB , Takeuchi Y , Yokota T ( 1997 ) Blockage of brassinosteroid biosynthesis and sensitivity causes dwarfism in garden pea . Plant Physiol 113 : 31 - 37 . PMID: 12223591 8. Krishna P ( 2003 ) Brassinosteroid-mediated stress responses . J Plant Growth Regul 22 : 289 - 297 . PMID: 14676968 9. Vriet C , Russinova E , Reuzeau C ( 2012 ) Boosting crop yields with plant steroids . Plant Cell 24 : 842 - 857 . doi: 10.1105/tpc. 111.094912 PMID: 22438020 10. Choe S , Fujioka S , Noguchi T , Takatsuto S , Yoshida S , Feldmann KA ( 2001 ) Overexpression of DWARF4 in the brassinosteroid biosynthetic pathway results in increased vegetative growth and seed yield in Arabidopsis . Plant J 26 : 573 - 582 . PMID: 11489171 11. Wu CY , Trieu A , Radhakrishnan P , Kwok SF , Harris S , Zhang K , et al. ( 2008 ) Brassinosteroids regulate grain filling in rice . Plant Cell 20 : 2130 - 2145 . doi: 10.1105/tpc. 107.055087 PMID: 18708477 12. Sakamoto T , Morinaka Y , Ohnishi T , Sunohara H , Fujioka S , Ueguchi-Tanaka M , et al. ( 2006 ) Erect leaves caused by brassinosteroid deficiency increase biomass production and grain yield in rice . Nat Biotechnol 24 : 105 - 109 . PMID: 16369540 13. Divi UK , Krishna P ( 2009 ) Brassinosteroid: a biotechnological target for enhancing crop yield and stress tolerance . N Biotechnol 26 : 131 - 136 . doi: 10.1016/j.nbt. 2009 . 07.006 PMID: 19631770 14. Blackwell HE , Zhao Y ( 2003 ) Chemical genetic approaches to plant biology . Plant Physiol 133 : 448 - 455 . PMID: 14555772 15. Sakurai A , Fujioka S ( 1997 ) Studies on biosynthesis of brassinosteroids . Biosci Biotechnol Biochem 61 : 757 - 762 . PMID: 9178548 16. Choe S , Dilkes BP , Fujioka S , Takatsuto S , Sakurai A , Feldmann KA ( 1998 ) The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22-alpha-hydroxylation steps in brassinosteroid biosynthesis . Plant Cell 10 : 231 - 243 . PMID: 9490746 17. Fujioka S , Yokota T ( 2003 ) Biosynthesis and metabolism of brassinosteroids . Annu Rev Plant Biol 54 : 137 - 164 . PMID: 14502988 18. Ohnishi T , Godza B , Watanabe B , Fujioka S , Hategan L , Ide K , et al. ( 2012 ) CYP90A1/CPD, a brassinosteroid biosynthetic cytochrome P450 of Arabidopsis, catalyzes C-3 oxidation . J Biol Chem 287 : 31551 - 31560 . doi: 10.1074/jbc. M112.392720 PMID: 22822057 19. Ohnishi T , Szatmari AM , Watanabe B , Fujita S , Bancos S , Koncz C , et al. ( 2006 ) C-23 hydroxylation by Arabidopsis CYP90C1 and CYP90D1 reveals a novel shortcut in brassinosteroid biosynthesis . Plant Cell 18 : 3275 - 3288 . PMID: 17138693 20. Castle J , Szekeres M , Jenkins G , Bishop GJ ( 2005 ) Unique and overlapping expression patterns of Arabidopsis CYP85 genes involved in brassinosteroid C-6 oxidation . Plant Mol Biol 57 : 129 - 140 . PMID: 15821873 21. Testa B , Jenner P ( 1981 ) Inhibitors of cytochrome P-450s and their mechanism of action . Drug Metab Rev 12 : 1 - 117 . PMID: 7028434 22. Rogerson TD , Wilkinson CF , Hetarski K ( 1977 ) Steric factors in the inhibitory interaction of imidazoles with microsomal enzymes . Biochem Pharmacol 26 : 1039 - 1042 . PMID: 880256 23. Sekimata K , Ohnishi T , Mizutani M , Todoroki Y , Han SY , Uzawa J , et al. ( 2008 ) Brz220 interacts with DWF4, a cytochrome P450 monooxygenase in brassinosteroid biosynthesis, and exerts biological activity . Biosci Biotechnol Biochem 72 : 7 - 12 PMID: 18175930 24. Asami T , Yoshida S ( 1999 ) Brassinosteroid biosynthesis inhibitors . Trends Plant Sci 4 : 348 - 353 . PMID: 10462767 25. Asami T , Min YK , Nagata N , Yamagishi K , Takatsuto S , Fujioka S , et al. ( 2000 ) Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor . Plant Physiol 123 : 93 - 100 . PMID: 10806228 26. Asami T , Mizutani M , Fujioka S , Goda H , Min YK , Shimada Y , et al. ( 2001 ) Selective interaction of triazole derivatives with DWF4, a cytochrome p450 monooxygenase of the brassinosteroid biosynthetic pathway, correlates with brassinosteroid deficiency in planta . J Biol Chem 276 : 25687 - 25691 . PMID: 11319239 27. Oh K , Yamada K , Asami T , Yoshizawa Y ( 2012 ) Synthesis of novel brassinosteroid biosynthesis inhibitors based on the ketoconazole scaffold . Bioorg Med Chem Lett 22 : 1625 - 1628 . doi: 10.1016/j.bmcl. 2011 . 12.120 PMID: 22264483 28. Yamada K , Yoshizawa Y , Oh K ( 2012 ) Synthesis of 2RS, 4RS-1-[2-phenyl-4-[2-(2-trifluromethoxyphenoxy)-ethyl]-1,3-dioxolan-2-yl-methyl]-1H-1,2,4-triazole derivatives as potent inhibitors of brassinosteroid biosynthesis . Molecules 17 : 4460 - 4473 . doi: 10.3390/molecules17044460 PMID: 22504831 29. Yamada K , Yajima O , Yoshizawa Y , Oh K ( 2013 ) Synthesis and biological evaluation of novel azole derivatives as selective potent inhibitors of brassinosteroid biosynthesis . Bioorg Med Chem 21 : 2451 - 2461 . doi: 10.1016/j.bmc. 2013 . 03.006 PMID: 23541834 30. Oh K , Yamada K , Yoshizawa Y ( 2013 ) Asymmetric synthesis and effect of absolute stereochemistry of YCZ-2013, a brassinosteroid biosynthesis inhibitor . Bioorg Med Chem Lett 23 : 6915 - 6919 . doi: 10. 1016/j.bmcl. 2013 . 09.056 PMID: 24269478 31. Fujioka S , Li J , Choi YH , Seto H , Takatsuto S , Noguchi T , et al. ( 1997 ) The Arabidopsis deetiolated2 mutant is blocked early in brassinosteroid biosynthesis . Plant Cell 9 : 1951 - 1962 . PMID: 9401120 32. Tocquin P , Corbesier L , Havelange A , Pieltain A , Kurtem E , Bernier G , et al. ( 2003 ) A novel high efficiency, low maintenance, hydroponic system for synchronous growth and flowering of Arabidopsis thaliana . BMC Plant Biol 3 : 2 . PMID: 12556248 33. Fujioka S , Takatsuto S , Yoshida S ( 2002 ) An early C-22 oxidation branch in the brassinosteroid biosynthetic pathway . Plant Physiol 130 : 930 - 939 . PMID: 12376657 34. Sakamoto T , Morinaka Y , Kitano H , Fujioka S ( 2012 ) New alleles of rice ebisu dwarf (d2) mutant show both brassinosteroid-deficient and -insensitive phenotypes . Amer J Plant Sci 3 : 1699 - 1707 . 35. Yamagami A , Nakazawa M , Matsui M , Tujimoto M , Sakuta M , Asami T , et al. ( 2009 ) Chemical genetics reveal the novel transmembrane protein BIL4, which mediates plant cell elongation in brassinosteroid signaling . Biosci Biotechnol Biochem 73 : 415 - 421 . PMID: 19202280 36. Seki M , Carninci P , Nishiyama Y , Hayashizaki Y , Shinozaki K ( 1998 ) High-efficiency cloning of Arabidopsis full-length cDNA by biotinylated CAP trapper . Plant J 15 : 707 - 720 . PMID: 9778851 37. Seki M , Narusaka M , Kamiya A , Ishida J , Satou M , Sakurai T , et al. ( 2002 ) Functional annotation of a full-length Arabidopsis cDNA collection . Science 296 : 141 - 145 . PMID: 11910074 38. Hayashi K , Kojima C ( 2008 ) pCold-GST vector: Anovel cold-shock vector containing GST tag for soluble protein production . Protein Expr Purif 62 : 120 - 127 . doi: 10.1016/j.pep. 2008 . 07.007 PMID: 18694833 39. Oh K , Asami T , Matsui K , Howe GA , Murofushi N ( 2006 ) Characterization of novel imidazole derivative, JM-8686, a potent inhibitor of allene oxide synthase . FEBS Lett 580 : 5791 - 5796 . PMID: 17022976 40. Xu W , Purugganan MM , Polisensky DH , Antosiewicz DM , Fry SC , Braam J ( 1995 ) Arabidopsis TCH4, regulated by hormones and the environment, encodes a xyloglucan endotransglycosylase . Plant Cell 7 : 1555 - 1567 . PMID: 7580251 41. Tanaka K , Asami T , Yoshida S , Nakamura Y , Matsuo T , Okamoto S ( 2005 ) Brassinosteroid homeostasis in Arabidopsis is ensured by feedback expressions of multiple genes involved in its metabolism . Plant Physiol 138 : 1117 - 1125 . PMID: 15908602 42. Chory J , Nagpal P , Peto CA ( 1991 ) Phenotypic and genetic analysis of det2, a new mutant that affects light-regulated seedling development in Arabidopsis . Plant Cell 3 : 445 - 459 . PMID: 12324600 43. Krebbers E , Seurinck J , Herdies L , Cashmore AR , Timko MP ( 1988 ) Four genes in two diverged subfamilies encode the ribulose-1,5-bisphosphate carboxylase small subunit polypeptides of Arabidopsis thaliana . Plant Mol Biol 11 : 745 - 759 . doi: 10.1007/BF00019515 PMID: 24272625 44. Leutwiler LS , Meyerowitz EM , Tobin EM ( 1986 ) Structure and expression of three light-harvesting chlorophyll a/b-binding protein genes in Arabidopsis thaliana . Nucleic Acids Res 14 : 4051 - 4064 . PMID: 3012462 45. Azpiroz R , Wu Y , LoCascio JC , Feldmann KA ( 1998 ) An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation . Plant Cell 10 : 219 - 230 . PMID: 9490745 46. Woo HR , Chung KM , Park JH , Oh SA , Ahn T , Hong SH , et al. ( 2001 ) ORE9, an F-box protein that regulates leaf senescence in Arabidopsis . Plant Cell 13 : 1779 - 1790 . PMID: 11487692 47. Shen H , Zhu L , Bu QY , Huq E ( 2012 ) MAX2 affects multiple hormones to promote photomorphogenesis . Mol Plant . 5 : 750 - 762 . doi: 10.1093/mp/sss029 PMID: 22466576 48. Kusaba M , Tanaka A , Tanaka R ( 2013 ) Stay-green plants: what do they tell us about the molecular mechanism of leaf senescence . Photosynth Res 117 : 221 - 234 . doi: 10.1007/s11120- 013 - 9862 -x PMID: 23771643 49. Cary AJ , Liu W , Howell SH ( 1995 ) Cytokinin action is coupled to ethylene in its effects on the inhibition of root and hypocotyl elongation in Arabidopsis thaliana seedlings . Plant Physiol 107 : 1075 - 1082 . PMID: 7770519 50. Kim GT , Fujioka S , Kozuka T , Tax FE , Takatsuto S , Yoshida S , et al. ( 2005 ) CYP90C1 and CYP90D1 are involved in different steps in the brassinosteroid biosynthesis pathway in Arabidopsis thaliana . Plant J 41 : 710 - 721 . PMID: 15703058 51. Kim GT , Tsukaya H , Uchimiya H ( 1998 ) The ROTUNDIFOLIA3 gene of Arabidopsis thaliana encodes a new member of the cytochrome P-450 family that is required for the regulated polar elongation of leaf cells . Genes Dev 12 : 2381 - 2391 . PMID: 9694802 52. Wang ZY , Nakano T , Gendron J , He J , Chen M , Vafeados D , et al. ( 2002 ) Nuclear-localized BZR1 mediates brassinosteroid-induced growth and feedback suppression of brassinosteroid biosynthesis . Dev Cell 2 : 505 - 513 . PMID: 11970900 53. Knight ZA , Gonzalez B , Feldman ME , Zunder ER , Goldenberg DD , Williams O , et al. ( 2006 ) A pharmacological map of the PI3-K family defines a role for p110 alpha in insulin signaling . Cell 125 : 733 - 747 . PMID: 16647110


This is a preview of a remote PDF: http://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0120812&type=printable

Keimei Oh, Tadashi Matsumoto, Ayumi Yamagami, Atushi Ogawa, Kazuhiro Yamada, Ryuichiro Suzuki, Takayuki Sawada, Shozo Fujioka, Yuko Yoshizawa, Takeshi Nakano. YCZ-18 Is a New Brassinosteroid Biosynthesis Inhibitor, PLOS ONE, 2015, DOI: 10.1371/journal.pone.0120812