In silico characterization and differential expression pattern analysis of conserved HMG CoA reductase domain isolated from Aconitum balfourii Stapf

3 Biotech (2016) 6:89 DOI 10.1007/s13205-016-0405-y ORIGINAL ARTICLE In silico characterization and differential expression pattern analysis of conserved HMG CoA reductase domain isolated from Aconitum balfourii Stapf Eti Sharma1 • Saurabh Pandey2 • A. K. Gaur1 Received: 3 October 2015 / Accepted: 14 February 2016 / Published online: 7 March 2016 Ó The Author(s) 2016. This article is published with open access at Springerlink.com Abstract The 3-hydroxy-3-methyl glutaryl CoA reductase (HMGR) is the key enzyme of mevalonate pathway in plants. A partial genomic DNA fragment encoding HMGR conserved domain (denoted as AbHMGR) is isolated from Aconitum balfourii Stapf. It comprises 871 bp encoding 290 amino acids. In silico analysis reveals that it had extensive similarities to other plant HMGR gene. Domain analysis of AbHMGR showed two highly conserved NADPH and HMG CoA domains. Docking study predicted inhibitor, substrate and cofactor binding sites in the protein. Expression analysis revealed that AbHMGR is similarly expressed in all tested tissues with differential pattern. The highest expression was found in leaf tissue. However, fold expression in root and shoot tissue was almost similar. Enzyme activity of HMGR was found to be much higher in leaf tissue as compared to other tissues. The highest aconitine content (0.015 %) was obtained in root tissues. Our data laid a foundation for further investigation of HMGR role in Aconitum balfourii. Electronic supplementary material The online version of this article (doi:10.1007/s13205-016-0405-y) contains supplementary material, which is available to authorized users. & Eti Sharma ; 1 Department of Molecular Biology and Genetic Engineering, College of Basic Sciences and Humanities, G. B. Pant University of Agriculture and Technology, Pantnagar 263145, Uttarakhand, India 2 Plant Molecular Biology Lab, The International Centre for Genetic Engineering and Biotechnology ICGEB, New Delhi, India Keywords Aconitine
Mevalonate pathway
3-Hydroxy3-methylglutaryl coenzyme A reductase
HMGR
Expression profiling Abbreviations IPP Isopentyl pyrophosphate HMGR 3-Hydroxy-3-methyl glutaryl-CoA reductase MVA Mevalonate pathway MEP 2-C-methyl-D-erythritol 4-phosphate Introduction Aconitum balfourii (A. balfourii) Stapf is one of the endangered herbs of the genus Aconitum. The main medicinal material in roots of A. balfourii Stapf is a diterpenoid alkaloid (Sultankhodzhaev and Nishnov 1995). The value of aconitine as a medicine has been recognized in modern times, and it now ranks as one of the most useful drugs, particularly in homeopathy, Ayurveda and Unani systems of medicine (Kirtikar and Basu 1965). It cures several ailments like rheumatism, arthritis, gout, neuralgia, sciatica, migraine and cancer. In homeopathy, aconite is used to dispel fear, anxiety and stress (Fleming 2000; Garmanchouk et al. 2005). Aconitine(s) are the part of diterpenoid alkaloids which originate from a terpenoid backbone (Cherney and Baran 2011). All terpenoids in plants are synthesized via central intermediate isopentyl pyrophosphate (IPP). IPP formation follows two distinct routes, the classical mevalonate pathway (MVA) which is effective in cytosol and another one is 2-C-methyl-D-erythritol 4-phosphate (MEP) in plastids (McGarvey and Croteau 1995). In MVA pathway, 123 89 Page 2 of 8 3-hydroxy-3-methyl glutaryl-CoA reductase (HMGR) is a key enzyme. It catalyzes the first committed step in which three molecules of acetyl Co A condense successively to form 3-hydroxy-3-methyl glutaryl-CoA (HMG CoA). The HMG-CoA is then reduced to yield mevalonic acid in an NADPH-dependent double reduction. This step is catalyzed by mevalonate:NADP oxido reductase, CoA acylating; 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR; EC 1.1.1.34) (Rogers et al. 1983). Evidence for the contribution of HMGR as the rate-limiting enzyme in isoprenoid biosynthesis has come from several investigators (Chappell and Nable 1987; Narita and Gruissem 1989). The major sub-cellular location of the enzyme appears to be the endoplasmic reticulum (ER) membrane. HMGR activity has also been reported to be associated with mitochondria and plastids (Laule et al. 2003). In the last few years, A. balfourii Stapf faces severe threat due to overexploitation. For saving the plant from extinction it is a necessity now to apply some biotechnological approaches other than tissue culture. Gene mining of rate-limiting enzymes of aconitine biosynthesis pathway and their studies is one of the strategies which needs to be focused. Fishing out the probable rate-limiting gene(s) and in silico characterize them is the beginning step. Until now, no information is available regarding cloning and characterization of HMGR full length or partial gene sequence from any species of genus Aconitum. Though HMGR genes have been isolated from many other plant species such as Camptotheca acuminata (Maldonado et al. 1997), Catharanthus roseus (Maldonado-Mendoza et al. 1992), Melon (Kato-Emori et al. 2001), and Taxus media (Liao et al. 2004). In the view of above, we successfully attempted the isolation of HMG CoA reductase gene from A. balfourii Stapf. The gene is designated as AbHMGR and its characterization was done with the help of bioinformatics tools. Expression pattern analysis and HMGR enzyme activities and aconitine content analysis at tissue level were also performed. 3 Biotech (2016) 6:89 NCBI database (http://www.ncbi.nlm.nih.gov). All the sequences were aligned by using Mega 4.0 software (Tamura et al. 2007). Primers were designed from obtained conserved regions by Primer3 online tool (Untergasser et al. 2007). The sequence of successful primer was HMGF GGCAACCACTGAAGGATGTT and HMGR ATGTTCTGAGCTGGGTCCTG. Amplification was carried out according to the following temperature profile: 5-min initial denaturation at 95 °C; 35 cycles of 94 °C for 1 min, 55 °C annealing temperature based on the Tm value of the primers for 1 min, 72 °C for 1 min; final extension of 10 min at 72 °C; and final hold at 4 °C. A single approximate 900-bp fragment was amplified which was directly cloned in pGEMT easy vector (Promega, USA) as per the kit instructions. Putative cloned HMG gene was sequenced using M13 universal primer in p-GEMT easy vector. In silico analysis The obtained sequence of AbHMGR was analyzed using several online and offline web services and softwares. Homology search was performed by BLASTX (Altschul et al. 1997). Sequence was translated into protein sequence using Expasy tool (http://ca.expasy.org/tools/dna.htmL). Protein functional analysis was done using INTERPROSCAN version 4.4 (Quevillon et al. 2005). Multiple sequence alignment of HMGR proteins was performed using ClustalW (Thompson et al. 1994) with default parameters. Phylogenetic relationship among other sequences was analyzed by Molecular Evolutionary Genetic Analysis (MEGA) software (version 5.2) software (Tamura et al. 2011) using UPGMA metho (...truncated)