Advanced search    

Search: authors:"Han Chen"

126 papers found.
Use AND, OR, NOT, +word, -word, "long phrase", (parentheses) to fine-tune your search.

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G...

An actin-binding protein ESPN is an independent prognosticator and regulates cell growth for esophageal squamous cell carcinoma

ESPN (Espin), an actin filament-binding protein, plays an important role in regulating the organization, dimensions, dynamics, and signaling capacities of the actin filament-rich, microvillus-type specializations that mediate sensory transduction in various mechanosensory and chemosensory cells. Recent few studies show that ESPN regulates metastasis and cell proliferation in...

The Moderating Effect of Guanxi on the Dynamic Capacity and Competitive Advantage of Chinese International Contractors

With the active support of the national policy “One Belt and One Road” Initiative, Chinese contractors seized this historic opportunity to accelerate strategic globalization, and they gradually stood out in international construction projects owing to their low-cost advantage. However, despite China having large-scale contractors and wide-range business, compared to developed...

Prenatal PPARα activation by clofibrate increases subcutaneous fat browning in male C57BL/6J mice fed a high-fat diet during adulthood

) Author Contributions Conceptualization: Pei-Min Chao. Data curation: Szu-Han Chen. Writing ± original draft: Szu-Han Chen, Pei-Min Chao. Writing ± review & editing: Pei-Min Chao. 12 / 15 13 / 15 14 / 15

Variations of topside ionospheric electron density near the dawn terminator in relation to geomagnetic activity

A statistical study to determine the influence of geomagnetic disturbances on the ionosphere across the dawn terminator at subauroral and middle latitudes is performed, based on the vertical electron density profiles measured by the GPS Occultation Experiment aboard the FORMOSAT-3/COSMIC satellites from August 2006 to July 2009. Three ranges of solar zenith angles are adopted to...

Single cell transcriptome analysis of MCF-7 reveals consistently and inconsistently expressed gene groups each associated with distinct cellular localization and functions

-Shien Chiang, Hsin-Chieh Shiau. Formal analysis: Yih-Shien Chiang, Yu-Feng Huang. Funding acquisition: Kuo-Ping Chiu. Investigation: Tzu-Han Chen. Methodology: Yih-Shien Chiang, Mohit K. Midha, Tzu-Han ... Chen, Kuo-Ping Chiu. Project administration: Tzu-Han Chen, Kuo-Ping Chiu. Resources: Kuo-Ping Chiu. Software: Yih-Shien Chiang. Supervision: Kuo-Ping Chiu. Validation: Yu-Feng Huang, Mohit K. Midha

Electron microscopic characteristics of interstitial cystitis/bladder pain syndrome and their association with clinical condition

: Jia-Fong Jhang, Yuan-Hong Jiang. Software: Jia-Fong Jhang. Supervision: Han-Chen Ho, Yuan-Hsiang Hsu, Hann-Chorng Kuo. Writing ? original draft: Jia-Fong Jhang. Writing ? review & editing: Han-Chen

Fuzzy Logic Controller Design for Intelligent Robots

2017 Academic Editor: Rafael Morales Copyright © 2017 Ching-Han Chen et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use

The molecular determinants for distinguishing between ubiquitin and NEDD8 by USP2

Ubiquitin (Ub) shares the highest sequence identity with neuronal-precursor-cell-expressed developmentally downregulated protein-8 (NEDD8) in the Ub-like protein family. However, different enzyme systems are precisely employed for targeting Ub and NEDD8 to specific substrates. The molecular determinants for distinguishing between Ub and NEDD8 by Ub-specific peptidases (USPs...

Boosting efferocytosis in alveolar space using BCG vaccine to protect host against influenza pneumonia

Efferocytosis by alveolar phagocytes (APs) is pivotal in maintenance of lung homeostasis. Increased efferocytosis by APs results in protection against lethal acute lung injury due to pulmonary infections whereas defective efferocytosis by APs results in chronic lung inflammation. In this report, we show that pulmonary delivery of Bacillus Calmette-Guerin (BCG) significantly...

Peer Education Group Intervention to Reduce Psychological Insulin Resistance: A Pilot Mixed-Method Study in a Chinese Population

Introduction Psychological insulin resistance (PIR) is common among type II diabetes (DM) patients. Although interventions to reduce PIR have been suggested, there is no standardized intervention to reduce PIR. This trial aimed to assess the preliminary effectiveness of a well-structured interventional patient group (for sample size calculation for larger trials), as well as the...

Variations of topside ionospheric electron density near the dawn terminator in relation to geomagnetic activity

A statistical study to determine the influence of geomagnetic disturbances on the ionosphere across the dawn terminator at subauroral and middle latitudes is performed, based on the vertical electron density profiles measured by the GPS Occultation Experiment aboard the FORMOSAT-3/COSMIC satellites from August 2006 to July 2009. Three ranges of solar zenith angles are adopted to...

Surgical resection of metachronous hepatic metastases from gastric cancer improves long-term survival: A population-based study

be planned. Author Contributions Conceptualization: Szu-Chin Li, Cheng-Hung Lee, Chung-Lin Hung, Jian-Han Chen. Data curation: Jian-Han Chen. Formal analysis: Cheng-Hung Lee, Jian-Han Chen ... . Methodology: Jin-Chia Wu, Jian-Han Chen. Project administration: Szu-Chin Li, Jian-Han Chen. Resources: Cheng-Hung Lee, Jian-Han Chen. Software: Jian-Han Chen. Validation: Cheng-Hung Lee, Jian-Han Chen

Nerve growth factor upregulates sirtuin 1 expression in cholestasis: a potential therapeutic target

-Chun Lin I-Wei Chang Po-Han Chen Ying-Hsien Kao This study investigated the regulatory role of nerve growth factor (NGF) in sirtuin 1 (SIRT1) expression in cholestatic livers. We evaluated the

Economic burden of cancer among patients with surgical resections of the lung, rectum, liver and uterus: results from a US hospital database claims analysis

Iftekhar Kalsekar Chia-Wen Hsiao Hang Cheng Sashi Yadalam Brian Po-Han Chen Laura Goldstein Andrew Yoo Objectives: To determine hospital resource utilization, associated costs and the risk of complications

Diffusion engineering of ions and charge carriers for stable efficient perovskite solar cells

. Ishikawa for technical support. Author information Author notesEnbing Bi, Han Chen & Fengxian Xie These authors contributed equally to this work AffiliationsState Key Laboratory of Metal Matrix ... Composites, School of Materials Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240, ChinaEnbing Bi, Han Chen, Xudong Yang & Liyuan HanPhotovoltaic Materials Unit, National Institute for

Revisit the Correlation between the Elastic Mechanics and Fusion of Lipid Membranes

Membrane fusion is a vital process in key cellular events. The fusion capability of a membrane depends on its elastic properties and varies with its lipid composition. It is believed that as the composition varies, the consequent change in C0 (monolayer spontaneous curvature) is the major factor dictating fusion, owing to the associated variation in GEs (elastic energies) of the...

A simpler and more cost-effective peptide biosynthetic method using the truncated GST as carrier for epitope mapping

Research Board, Department of Science and Technology, Government of India. Author Contributions Investigation: Hai-Ping Tang, Ling-Han Chen, Wen-Bo Lian, Jian-Min Zhan, Chao-Neng Ji, Shao-Hua Gu