Organization of the Human GLUT2 (Pancreatic β-Cell and Hepatocyte) Glucose Transporter Gene

JUN TAKEDA 0 TOSHIAKI KAYANO 0 HIROFUMI FUKOMOTO 0 GRAEME I. BELL 0 0 From the Howard Hughes Medical Institute and the Departments of Biochem- istry and Molecular Biology, and Medicine, The University of Chicago , Chicago , Illinois. Howard Hughes Medical Institute , 5841 South Maryland Avenue, MC1028, Chicago, IL 60637. Received for publication 27 January 1993 and accepted 22 February 1993. NIDDM, non-insulin-dependent diabetes mellitus; MODY , maturity-onset diabetes of the young; kb , kilobase pairs; STRP, simple tandem repeat DNA polymorphism; RFLP, restriction fragment-length polymorphism; bp, base pair The gene encoding the predominant facilitative glucose transporter expressed in pancreatic fJ-cells and hepatoctyes, termed GLUT2, has been cloned and characterized. The human GLUT2 gene is composed of 11 exons spanning - 3 0 kilobases. The sequence of the promoter region and all exons and adjacent intron regions has been determined and deposited in the GenBank database. Two highly polymorphic simple tandem repeat DNA polymorphisms useful for linkage studies were localized in introns 1 and 4a. In addition, a 168-base pair insertion/deletion polymorphism was identified in intron 3. The characterization of the human GLUT2 gene will facilitate studies of its role in the development of diabetes mellitus. Diabetes 42:773-77, 1993 - Ninsulin action on peripheral tissues including IDDM is a heterogeneous disorder characterized by defects in insulin secretion and in liver, muscle, and adipose tissue (1). Its underlying causes are uncertain, but it seems likely that both genetic and environmental factors contribute to its development. Recently, a great deal of effort has been directed toward identifying genes whose mutation may increase the risk of developing NIDDM (2). These efforts have led to the identification of diabetes-susceptibility genes on chromosomes 7 and 20 in families with MODY (3,4), a form of NIDDM characterized by onset before 25 yr of age and autosomal dominant inheritance. Although the identity of the gene on chromosome 20 has not been determined, it has been shown that mutations in the glucokinase gene on chromosome 7 can cause diabetes and are a common cause of MODY among some groups (5,6). The demonstration that mutations in glucokinase, an enzyme that controls the first rate-limiting reaction in glycolysis, can cause diabetes suggests that other proteins involved in the transport and metabolism of glucose should also be examined for a role in contributing to the development of this genetically heterogeneous disorder. Herein we report the exon-intron organization and partial sequence of the human GLUT2 gene, which will facilitate molecular genetic studies of its contribution to the development of impaired p-cell function and hepatic insulin resistance. RESEARCH DESIGN AND METHODS Isolation of the human GLUT2 gene. The human GLUT2 gene was isolated from the fetal human liver library of Lawn et al. (7) by hybridization with the human GLUT2 cDNA (8). The sequences of the exons and adjacent intron segments were determined by using the dideoxy-chain termination method after subcloning appropriate DNA fragments into M13mp18 or M13mp19. Location of transcriptional start site by primer extension. Primer extension was conducted as described previously (9). Two primers were used for primer extension studies: hGT2-1, 5'-GGAGTCCTGTCAATTCCA GG-3', and hGT2-2, 5'CAAGTCTAATCTTCTCAGCG3'. Briefly, 50 |xg of adult human liver RNA was mixed with 75 fmol of 32P-end-labeled primer in a solution of 50 mM Tris-HCI (pH 8.3), 50 mM KCI, and 8 mM MgCI2. After denaturation at 94C for 4 min, the primer was allowed to anneal with the RNA at 56C for 1 h. Primer extension was initiated by the addition of dNTPs and M-MLV reverse transcriptase, and the reaction was incubated at 42C for 1 h. The primer extended products were separated on a Sequence at exon-intron junction 5'-Splice donor site 3'-Splice acceptor site The sequences of the intron-exon junctions are indicated. Exon sequences are in capital letters, and intron sequences are in lowercase letters. The approximate sizes of the introns are noted. The size of exon 10 varies because of the presence of multiple polyadenylation sites (8); the size of exon 10 to the first, most proximal site, is indicated. The partial sequence of the human GLUT2 gene, 7.5 kb, which includes the sequence of each exon and extended sequence of each intron has been deposited in the GenBank database and also is available from the authors. Introns in phase I, II, and 0 interrupt coding sequence after the first, second, and third nucleotides, respectively, in a codon. CAAT TATA - 36 ATTACTGCCACATAACACATGCCTTGAAATGTGATT agtggaacaaaggtattgaagccacaggttgctgaggcaaagcacttattgattagattcccatcaatattcagctgccgctgagaagat MetThrGlu gaataaacaggcaggagctagtcaggtgcatgtgccacactcacacaagacctggaattgacaggactcccaactagtacaATGACAGAA FIG. 2. Sequence of the promoter region and exon 1 of human GLUT2 gene. (*), the putative transcriptlonal start noted as nucleotide 1. The 5'-untranslated region is shown In lowercase letters. The 5'-end of the published cDNA sequence is at nucleotide 275; nucleotldes 98-274 were additionally obtained from a human liver cDNA library (J.T., unpublished observations). Sequences that may represent binding sites for transcriptional regulatory proteins are shown. The nucleotide at the beginning of each line is indicated. and small intestine, the presence of this variant splice- STRP is particularly useful for family studies because donor site does not appear to affect posttranscriptional both alleles of the GLUT2 gene can be distinguished in processing of the human GLUT2 mRNA precursor. 91% of unrelated individuals (17). The second STRP, The sequence of the putative promoter region of the GLUT2-2, is in intron 4a and is adjacent to the spliceGLUT2 gene is shown in Fig. 2. Primer extension studies donor site (GenBank accession numberL09678). It is that use oligonucleotide hGT2-1 suggest that the tran- of the form (CA)n and has a heterozygosity in Caucasians scriptional start site in liver is located 309 nucleotides of 60% (18,19). In addition to these two STRPs, an upstream of the codon at which translation begins. insertion/deletion polymorphism is located in intron 3 Similar results to those shown in Fig. 2 were obtained with (GenBank accession numberL09677). This polymoroligonucleotide hGT2-2. Scanning of the sequence of phism, which was predicted from studies of RFLPs in the the promoter showed the presence of numerous potential GLUT2 gene (20), results from the presence of one or two binding sites for transcription factors including a TATA- copies of a 168-bp sequence; the frequency of chromolike motif (12), CAAT box (12), CCAAT/enhancer binding somes with two copies is - 0 . 1 . The human GLUT2 gene site (C/EBP) (13), liver-specific transcription factor LF-B1/ has been localized by in situ hybridization to chromoHNF1-a binding site (14), A (...truncated)