Bidirectional modulation of endogenous EpCAM expression to unravel its function in ovarian cancer

FULL PAPER British Journal of Cancer (2013) 108, 881–886 | doi: 10.1038/bjc.2013.45 Keywords: EpCAM; ATFs; ovarian cancer; zinc-fingers Bidirectional modulation of endogenous EpCAM expression to unravel its function in ovarian cancer B T F van der Gun1, C Huisman1, S Stolzenburg1,2, H G Kazemier1, M H J Ruiters1,3, P Blancafort2,4 and M G Rots*,1 1 Epigenetic Editing, Department of Pathology and Medical Biology, University of Groningen, University Medical Center Groningen, Hanzeplein 1, Groningen 9713 GZ, The Netherlands; 2Department of Pharmacology, University of North Carolina, Chapel Hill, NC, USA; 3Synvolux Therapeutics Inc., LJ. Zielstraweg 1, Groningen 9713 GX, The Netherlands and 4Cancer Epigenetics Group, School of Anatomy, Physiology and Human Biology, The University of Western Australia M309, 35 Stirling Highway, Crawley, Western Australia 6009, Australia Background: The epithelial cell adhesion molecule (EpCAM) is overexpressed on most carcinomas. Dependent on the tumour type, its overexpression is either associated with improved or worse patient survival. For ovarian cancer, however, the role of EpCAM remains unclear. Methods: Cell survival of ovarian cancer cell lines was studied after induction or repression of endogenous EpCAM expression using siRNA/cDNA or artificial transcription factors (ATF) consisting of engineered zinc-fingers fused to either a transcriptional activator or repressor domain. Results: Two ATFs were selected as the most potent down- and upregulator, showing at least a two-fold alteration of EpCAM protein expression compared with control. Downregulation of EpCAM expression resulted in growth inhibition in breast cancer, but showed no effect on cell growth in ovarian cancer. Induction or further upregulation of EpCAM expression decreased ovarian cancer cell survival. Conclusion: The bidirectional ATF-based approach is uniquely suited to study cell-type-specific biological effects of EpCAM expression. Using this approach, the oncogenic function of EpCAM in breast cancer was confirmed. Despite its value as a diagnostic marker and for immunotherapy, EpCAM does not seem to represent a therapeutic target for gene expression silencing in ovarian cancer. The epithelial cell adhesion molecule (EpCAM; CD326) is a transmembrane glycoprotein, overexpressed on the vast majority of carcinomas compared with healthy epithelium (Went et al, 2004). Epithelial cell adhesion molecule is used as a diagnostic marker, has prognostic value for some tumours (Went et al, 2008) and even serves as a therapeutic target in antibody-based therapies (Baeuerle and Gires, 2007). Recently, EpCAM has been identified as a marker for cancer-initiating stem cells (Visvader and Lindeman, 2008) and was shown to be involved in the Wntsignaling pathway (Maetzel et al, 2009). Upon intramembrane proteolysis of EpCAM, the intracellular domain functions with bcatenin as part of a transcriptional complex inducing c-myc and cyclin A/E expression. In breast cancer, high EpCAM expression is associated with poor prognosis, (Spizzo et al, 2004), which is consistent with the finding that induction of EpCAM in the EpCAM-negative breast cancer cell line Hs578T showed increased proliferation compared with the empty vector control (Gostner et al, 2011). In addition, RNAi-based silencing of EpCAM expression in breast cancer cell lines reduced the oncogenic potential of the treated cells (Osta et al, 2004) and EpCAM *Correspondence: Professor Dr MG Rots; E-mail: Received 5 October 2012; revised 21 December 2012; accepted 11 January 2013; published online 12 February 2013 & 2013 Cancer Research UK. All rights reserved 0007 – 0920/13 www.bjcancer.com | DOI:10.1038/bjc.2013.45 881 BRITISH JOURNAL OF CANCER expression rescued by cDNA constructs increased cell invasion (Sankpal et al, 2011). Despite this oncogenic function of EpCAM in breast carcinogenesis, for several tumour types the biological role of EpCAM is far from clear (van der Gun et al, 2010). Clinical observations in ovarian cancer suggest that for this tumour type EpCAM overexpression correlates with decreased overall survival, especially in patients with FIGO stage III/IV (Spizzo et al, 2006), although this could not be confirmed by independent studies (Kim et al, 2003; Heinzelmann-Schwarz et al, 2004). In addition, EpCAM has been described as a marker of human ovarian cancer stem/ progenitor cells (Meirelles et al, 2012) and introduction of human EpCAM cDNA in EpCAM-negative mouse ovarian stem-like tumour cells enhanced the tumour-initiating ability (Motohara et al, 2011). Although these studies are far from definitive, they do suggest that downregulation of endogenous EpCAM expression might decrease the oncogenic potential in ovarian cancer. To our knowledge, so far no data exist on EpCAM expression modulation in human ovarian cell culture systems in contrast to breast and many other tumour types. To investigate the functional role of EpCAM, a method to modulate bidirectionally endogenous expression levels would provide biologically relevant insights. To this end, artificial transcription factors (ATFs) can be constructed by fusing a gene-specific DNA-binding domain to transcriptional modulators (Uil et al, 2003). DNA-binding domains often used are engineered six zinc-fingers targeting an 18-base-pair unique sequence, thereby, enabling specific targeting of virtually any gene (Sera, 2009). Artificial transcription factors are appealing because they allow for both up- (Beltran and Blancafort, 2011) and downregulation (Stolzenburg et al, 2012) of gene expression, by fusing an activator or repressor to the zinc-fingers. Furthermore, compared with siRNA approaches where many mRNA copies have to be targeted, only two gene copies need to be targeted by ATFs. In addition, compared with gene delivery approaches, which often involve the expression of only one cDNA variant, ATFs can induce all splice variants in their natural ratios. Importantly, using this approach, epigenetic effector domains can be targeted to the gene of interest to induce mitotically stable gene expression modulation (De Groote et al, 2012). In this study, bidirectional endogenous EpCAM modulation by ATFs was exploited to investigate the biological role of EpCAM overexpression in ovarian cancer. Endogenous EpCAM expression modulation the first transduction. As the IRES-GFP present in the pMX vector showed a relative low GFP signal (Beerli et al, 2000), cotransduction with a strong GFP reporter was used to monitor toxicity by downregulation of EpCAM expression in SKBR3 cells. siRNA or cDNA transfection. siRNA-EpCAM 750 ng (sense, 50 GGAGAUCACAACGCGUUAUUU and antisense, 50 -AUAA CGCGUUGUGAUCUCCUU) or irrelevant-siRNA (irr-siRNA) (1022076; Qiagen, Venlo, Netherlands) or plasmid DNA (generously provided by Giepmans, UMCG and Cirulli (Washington, DC, USA)) (Schnell et al, 2012) was complexed in 200 ml HBS with 20 ml SAINT-2:DOPE (SD; 0.75 mM) (Synvolux, Groning (...truncated)