Antitumor effect of B16 melanoma cells genetically modified with the angiogenesis inhibitor RNasin

D 2001 Nature Publishing Group 0929-1903/01/$17.00/+0 www.nature.com/cgt Antitumor effect of B16 melanoma cells genetically modified with the angiogenesis inhibitor RNasin Rafael Botella-Estrada,1 Gema Malet,2 Fernando Revert,2 Francisco DasõÂ,2 Antonio Crespo,2 Onofre SanmartõÂn,1 Carlos GuilleÂn,1 and Salvador F. AlinÄo2 1 2 Servicio de DermatologõÂa, Instituto Valenciano de OncologõÂa, Universitat de ValeÁncia, Valencia, Spain; and Departamento de FarmacologõÂa, Facultad de Medicina y OdontologõÂa, Universitat de ValeÁncia, Valencia, Spain. The growth of new blood vessels is an essential condition for the development of tumors with a diameter greater than 1 ± 2 mm and also for their metastatic dissemination. RNasin, the placental ribonuclease inhibitor, is known to have antiangiogenic activity through the inhibition of angiogenin and basic fibroblast growth factor. Nevertheless, the administration of the recombinant form of a protein poses several limitations; as a result, we have studied the antitumor effect of RNasin in a murine gene therapy model. RNasin cDNA was subcloned into the pcDNA3 expression vector, and the resulting recombinant plasmid was used to transfect the B16 murine melanoma cell line. An RNasin inverted construction was used as control. Mice intravenously injected with clones expressing RNasin showed a significant inhibition of tumor metastatic progression with respect to control groups ( P < .001 ) and survived longer ( P < .001 ) . Tissue sections from RNasin - expressing cell tumors showed a lower number of blood vessels when compared to tissue sections from mice lungs that had been inoculated with control cell lines. The results of these experiments show that the genetic modification of tumor cells with RNasin cDNA yields a significant antitumor effect, and suggest that this effect is at least partially the result of angiogenesis inhibition. Cancer Gene Therapy ( 2001 ) 8, 278 ± 284 Key words: Angiogenesis; antiangiogenesis; gene therapy; melanoma; RNasin; ribonuclease inhibitor. A ntiangiogenic gene therapy has been shown to be an important and potent procedure for limiting tumor growth and metastasis without significant side effects because neoplastic progression relies on the ability of the tumor to recruit a new vascular supply.1 This new strategy offers a unique opportunity to design an effective and selective therapy for all types of cancer, while minimizing the risks of inducing drug resistance.2 Antiangiogenic gene therapy has focused on two main aspects: ( a ) suppressing the expression of, or disrupting, specific signaling pathways of angiogenic factors;3 ± 5 and ( b) transferring genes encoding antiangiogenic molecules that cause selective apoptosis of endothelial cells.6 ± 8 In this context, the search for new antiangiogenic agents continues while awaiting the results of ongoing clinical trials involving a number of antiangiogenic drugs. RNasin is a ribonuclease inhibitor that has been reported to exhibit antiangiogenic activity.9 RNasin inhibits the strong angiogenic response generated by either basic fibroblast growth factor ( b- FGF ) 9 or angiogenin.10 In addition, Polakowski et al9 demonstrated the ability of RNasin to inhibit tumor growth in mice when administering the recombinant molecule systemically. To examine the potential role of RNasin in the gene therapy of cancer, we transfected the murine melanoma cell line B16 with RNasin Address correspondence and reprint requests to Rafael Botella - Estrada, Servicio de DermatologõÂa, Instituto Valenciano de OncologõÂa, P. BeltraÂn BaÂguena, Valencia 46009, Spain. E-mail address: 278 cDNA, and clones of B16 tumor cells expressing the exogenous gene were isolated to study their in vivo growth characteristics in an experimental lung metastases model. We expected that intratumor RNasin production by genetically modified cells could contribute to limiting tumor growth by decreasing the number of vessels within the tumor. Although it has been demonstrated that the systemic administration of angiogenesis inhibitors, such as angiostatin and endostatin, can mediate tumor regression,11,12 a substantial body of evidence points to the importance of a ``local balance'' in angiogenesis13 and of cell ± matrix interactions in tumor progression.14,15 Local delivery of RNasin within the tumor should be able to alter the angiogenic balance more effectively, and above all more persistently, than systemic administration of the protein. Our data show that the intravenous ( i.v.) injection of melanoma cells expressing RNasin mRNA leads to a great decrease in the number of intratumor vessels, with a statistically significant reduction in the number of lung metastases, and increased survival among tumor-bearing mice. MATERIALS AND METHODS Generation of RNasin constructs The pGEM plasmid containing human RNasin cDNA was generously provided by Dr. Curiel ( University of Alabama at Birmingham, UT ). A 1.64 -kb EcoRI fragment of pGEM containing the entire RNasin coding sequence was subcloned into the EcoRI site of the pcDNA3 (Invitrogen, Carlsbad, Cancer Gene Therapy, Vol 8, No 4, 2001: pp 278 ± 284 279 BOTELLA - ESTRADA, MALET, REVERT, ET AL: ANTIANGIOGENIC GENE THERAPY WITH RNASIN CA ) expression vector. An asymmetric XhoI restriction site within the EcoRI fragment was used to orientate the plasmid. Two plasmids were then constructed: ( a) p3C -RNasin, with the full coding sequence of RNasin cDNA in the sense 50 ± 30 orientation, allowing the expression of RNasin protein; and ( b) p3C -éRNasin, with the RNasin cDNA in the reverse antisense 30 ±50 orientation (which resulted in no protein synthesis and was used as transfection control ) . Plasmids were amplified in DH5 and purified using Qiagen Maxi kit Endofree (Qiagen, Santa Clarita, CA ) . could be identified from the beginning as arising from a single individual cell. RNasin mRNA expression Total cellular RNAwas isolated from each clone (Qiagen kit) and expression of RNasin was analyzed by reverse transcription polymerase chain reaction ( RT- PCR ) ( Gibco ). The following oligonucleotides were used: two internal primers: IHRP -475, 50 -GCACCTCAGCGACAACCTCTT-30 and IHRP -1065, 50 - ACTTCACCCACAGCGACTCCA -30, whose complementary sequences started at 475 and 1065 bp of the RNasin sequence, respectively, giving rise to a 611- bp band; and a third primer located within the T7 promoter, pU1: 50 -ACGACTCACTATAGGGAGAC -30 which combined with the 1065 internal primer, yielded a 1100- bp band only in those RNA possessing the sense orientation. The DNA sequence of the amplified band was verified by sequence analysis (Perkin Elmer ). Total RNA from lungs was purified using TRI -REAGENT ( Sigma ). To assess RNasin expression, 0.2 g was analyzed by one -step RT- PCR (Gibco) and PCR of a dilution 1:10 of the RT-PCR product with Taq Polymerase ( Biotools ) using the following primers: RNasin- F1, 50 - CCAAGCCGGACTTCAAGGA -30, and RNasin- R1, 50 -GGA (...truncated)