BCR-ABL mediated repression of miR-223 results in the activation of MEF2C and PTBP2 in chronic myeloid leukemia

Letters to the Editor 1578 12 Walter MJ, Ding L, Shen D, Shao J, Grillot M, McLellan M et al. Recurrent DNMT3A mutations in patients with myelodysplastic syndromes. Leukemia 2011; 25: 1153–1158. 13 Thol F, Winschel C, Ludeking A, Yun H, Friesen I, Damm F et al. Rare occurrence of DNMT3A mutations in myelodysplastic syndromes. Haematologica 2011; 96: 1870–1873. 14 Jankowska AM, Makishima H, Tiu RV, Szpurka H, Huang Y, Traina F et al. Mutational spectrum analysis of chronic myelomonocytic leukemia includes genes associated with epigenetic regulation: UTX, EZH2, and DNMT3A. Blood 2011; 118: 3932–3941. Supplementary Information accompanies this paper on the Leukemia website (http://www.nature.com/leu) BCR-ABL mediated repression of miR-223 results in the activation of MEF2C and PTBP2 in chronic myeloid leukemia Leukemia (2013) 27, 1578–1580; doi:10.1038/leu.2012.339 8 n = 35 r = (-) 0.5087 p = 0.0018 4 2.5 2 0 2.0 0 1 2 3 miR-223 4 5 1.5 1.0 0.5 0.0 1.0 vector miR-223 vector miR-223 4 0.5 Fold change miR-223 1.5 Fold change BCR-ABL 6 0.0 DMSO (n=3) IM (n=3) 250 Sokal score Posttranscriptional regulation by microRNAs (miRNAs) has an important role in modulating the gene regulatory network as miRNAs can negatively regulate protein translation by binding to the complementary sequences of the 30 untranslated region (UTR) of messenger RNA.1 As in other leukemia, abnormal expression of several miRNAs is reported in chronic myeloid leukaemia (CML).2 Downregulation of miR10a leads to abnormal proliferation of CML cells through regulation of USF2 gene expression, whereas forced expression of miR-328 that is lost in the blast phase of the disease rescues C/EBP alpha-driven granulocytic maturation and impairs survival of CML cells.3,4 Recently, one of the miRNA that is attracting considerable attention in hematopoiesis is miR-223 as it resembles a myeloid gene and its expression is known to increase towards myeloid differentiation. Expression of miR-223, which was identified bioinformatically, is controlled by three transcription factors, C/EBPa, PU.1 and NFI-A. C/ EBP-a and PU.1 positively regulates miR-223, whereas NFI-A competes for C/EBPa binding site and maintains miR-223 at low levels.5,6 BCR-ABL inhibits the translation of C/EBPa mRNA by stabilizing the RNA-binding protein hnRNP E2.7 As CML is characterized by chronic granulocytic maturation arrest and the transcription factors involved in miR-223 expression are deregulated in CML, we predicted that miR-223 may have a role in CML disease biology. We investigated the miR-223 and BCR-ABL expression pattern in the peripheral blood samples from CML patients (n ¼ 35) by real-time quantitative PCR (RQ-PCR). Relative expression values for each sample were calculated by using 2  DCt method. Spearman’s correlation test shows the existence of a negative correlation between the expression profiles of BCR-ABL and miR-223 (Figure 1a). To further validate this, bone marrow mononuclear cells from three untreated CML patients were isolated and treated with 2 mM imatinib, a BCR-ABL kinase inhibitor. After 48 h of treatment, miR-223 expression was analyzed by RQ-PCR. MiR-223 expression was upregulated in imatinib-treated bone marrow mononuclear cells as compared with dimethyl sulfoxide control (Figure 1b). Hence, these studies support the notion that BCR-ABL mediates repression of miR-223, probably, by deregulating C/EBPa. However, normal and complete hematological response (CHR) cases failed to show any appreciable correlation with naive CML cases as because of the different cell type. MiR-223 relative expression was correlated in CML with the available clinical parameters. Among the available clinical data, sokal score and neutrophil percentage were found to be significant. MiR-223 expression was positively correlated with mature neutrophil percentage, and this data also supports the role of miR-223 in granulocytic maturation as shown by Fazi et al.6 (data not shown). Spearman’s correlation test demonstrated the existence of a negative correlation between miR-223 expression levels and sokal score. This suggests that miR-223 expression is 200 3 2 1 0 150 100 n = 22 r = (-) 0.5915 p = 0.0037 50 0 0 2 1 miR-223 3 Figure 1. BCR-ABL mediated miR-223 downregulation and clinical outcome in CML. (a) Relative expression levels of miR-223 and BCRABL were analyzed by using Spearman’s correlation test. It shows the existence of a negative correlation between miR-223 and BCRABL. (b) miR-223 expression in bone marrow mononuclear cells (BMMNCs) from three patients were treated with dimethyl sulfoxide (control) and 2 mM imatinib. Relative expression was calculated by using 2  DCt method. miR-223 is upregulated in imatinib-treated BMMNC cells (paired t-test, P ¼ 0.03). (c) Spearman’s correlation test shows the existence of negative correlation between miR-223 expression and sokal score. (d) miR-223 expression in lenti-vector and lenti-miR-223 transduced K562 cells. (e) Myeloperoxidase expression in lenti-vector and lenti-miR-223 transduced K562 cells. negatively correlated with disease risk (Figure 1c) and may be used as a disease-risk prediction marker. To define the role of miR-223 in CML, we generated a cell line model system in which K562 cells were transduced with a lentiviral vector expressing miR-223. After 7 days of transduction, K562 cells were analyzed for miR-223 expression to confirm the overexpression of miR-223 (Figure 1d). To verify the role of miR-223 in granulocytic maturation, we analyzed myeloperoxidase expression at the RNA level. Figure 1e shows that MPO is upregulated at mRNA level in Accepted article preview online 23 November 2012; advance online publication, 21 December 2012 Leukemia (2013) 1567 – 1614 & 2013 Macmillan Publishers Limited Letters to the Editor Fold change SACS, PTBP2, PURB, SLC39A8 CBF, RHOB, HHEX, MEF2C MEF 2C expression 23 A2 n RN ca mi get s tar m iR ne NA ut 2 ro 23 ph + il /- 1579 PTBP 2 expression PURB expression 1.5 1.5 1.5 1.0 1.0 1.0 0.5 0.5 0.5 0.0 0.0 0.0 miR-223 vector vector miR-223 vector miR-223 K562 cells, +/imatinib Luciferase ORF 3’UTR 0.025 0.020 PTBP2 WT 3’UTR 5’ PTBP2 n = 28 0.015 miR - 223 3’ PTBP2 MU 3’UTR 5’ r = (-) 0.5003 p = 0.0067 0.010 ...GUGGCAGUUUUCUAAAACUGACA... ⏐⏐⏐ ⏐⏐⏐⏐⏐⏐⏐ ⏐ ACCCCAUAAACUGUUUGACUGU ⏐⏐⏐ ⏐⏐⏐ ⏐ ...GUGGCAGUUUUCUAAAACACUCA... 0.005 ns 1.5 0.000 0 1 2 3 miR-223 4 5 RLU 1.0 miR - 223 4 0.5 n = 35 3 r = (-) 0.6291 p = 0.0001 2 0.0 WT vector 1 MT miR-223 MU vector MU miR-223 0 0 1 2 3 MEF2C Figure 2. miR-223 targets screening. RNA-binding protein PTBP2 is a direct target of miR-223. (a) miR-223 target enrichment from the GEO microarray data sets and TargetScan database. (b) Significantly downregulated miR-223 targets MEF2C, PTBP2 and PURB in lenti-miR-223 transduced K562 cells. Results are representative of two independent experiments in duplicates. (c) Correlation of PTBP2 e (...truncated)