Expression and function of phosphodiesterases (PDEs) in the rat urinary bladder

Zhu et al. BMC Urology (2017) 17:54 DOI 10.1186/s12894-017-0244-0 RESEARCH ARTICLE Open Access Expression and function of phosphodiesterases (PDEs) in the rat urinary bladder Xiaofei Zhu1†, Kui Zhai2*†, Yue Mi3† and Guangju Ji2* Abstract Background: It has been shown that hosphodiesterases (PDEs) play an important role in mediating the smooth muscle tone of rat urinary bladder. However, the gene expression profiles of them were still unknown. Methods: Urinary bladder Strips were obtained from both neonatal and adult Sprague-Dawley rats. RT-PCR/western blot and organ bath were used to measure the expression and function of PDEs. Results: Adult rat urinary bladder expressed various PDE mRNA with the following rank order: PDE5A ≈ PDE9A ≈ PDE10A > PDE2A ≈ PDE4A ≈ PDE4D > PDE4B ≈ PDE3B ≈ PDE8B ≈ PDE7A ≈ PDE7B > PDE1A. PDE1B, PDE1C, PDE3A, PDE4C, PDE8A, and PDE11A were not detected. Of interest, the mRNA and protein of PDE3A were significantly decreased in adult rat urinary bladder compared to neonatal rat urinary bladder. Cilostamide, a specific inhibitor for PDE3, significantly inhibited the amplitude and frequency of carbachol-enhanced phasic contractions of neonatal rat bladder strips by 38.8% and 12.1%, respectively. Compared to the neonatal rat bladder, the effect of cilostamide was significantly blunted in adult rat urinary bladder: the amplitude and frequency of carbachol-enhanced phasic contractions were decreased by 13.4% (P < 0.01 vs neonatal rat bladder) and 4.4%, respectively. However, the mRNA and the protein levels of PDE3B were similar between neonatal and adult rat bladder. Conclusion: We found that several PDE isoforms were expressed in the rat urinary bladder with distinct levels. Moreover, we showed that the function of PDE3 was blunted in adult rat bladder likely due to the decreased expression of PDE3A. Keywords: Gene expression, Phasic contraction, Phosphodiesterases, Rat urinary bladder Background Through mediating cAMP and/or cGMP levels, phosphodiesterases (PDEs) are involved in several physiological processes of urinary bladder. Artim et al. showed that PDE5 mediated the phasic contractions of neonatal rat bladder through nitric oxide-cGMP- protein kinase G pathway [1]. Our previous study found that PDE3 and PDE4 regulated the phasic contractions of neonatal rat bladder through PKG and PKA pathways, respectively [2]. To date, 11 PDE families have been identified [3]: 3 families (PDEs 4, 7, and 8) selectively hydrolyze cAMP, 3 families selectively hydrolyze cGMP (PDEs 5, 6, and 9), * Correspondence: ; † Equal contributors 2 National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, 15 Datun Road, Beijing 100101, China Full list of author information is available at the end of the article and 5 families (PDEs 1, 2, 3, 10, and 11) hydrolyze both cyclic nucleotides with varying efficacies. As some of these PDE families consist of more than one gene and some genes are alternatively spliced, 21 different isoforms and more than 50 variants have been identified [4]. The urinary bladder is the organ that collects urine excreted from kidneys before disposal by urination. One of the most important features of the urinary detrusor smooth muscle is its ability to generate considerable phasic contractions [1, 2, 5]. These spontaneous phasic contractions change markedly with age [5]: during the first 2–3 weeks of life, they are characterized by highamplitude low-frequency spontaneous contractions; then, they turn into low-amplitude high-frequency pattern characteristic of normal adult rat. The spontaneous © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Zhu et al. BMC Urology (2017) 17:54 activities in neonatal rat bladder are likely to be myogenic [6] and can also be modulated by the interstitial cell network [7–9]. In this study, we tested the expression profiles of all PDEs families except PDE6 (its expression is restricted to the retina) in adult rat urinary bladder with RT-PCR techniques. Moreover, we evaluated the functional role of PDE3 in mediating the phasic contraction of neonatal and adult rat bladder strips through pharmacological method. Methods Animals and regents Neonatal (10-day old) and adult (90-day old) SpragueDawley rats were purchased from Vital River Laboratories (Beijing, China). All animal procedures described in this study were performed according to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85–23, revised 1996), and with approval from the Institute of Biophysics Committee on Animal Care. The rat was anesthetized by 5% chloral hydrate and the whole bladder was removed, placed into cold Tyrode solution composed of (mM): 137 NaCl, 5.4 KCl, 1.8 CaCl2, 1.0 MgCl2, 10 glucose, 10 HEPES, (pH 7.4). After the cleaning of the fat tissues, the bladder was cut into two longitudinal pieces by using a fine dissecting scissors along the axis from the neck to the fundus. Cilostamide (Cil) was from Tocris Bioscience (Bristol, UK). All other reagents were from Sigma Aldrich unless mentioned. Polymerase chain reaction (PCR) Reverse transcriptional-PCR were performed as previously reported [2, 10]. Standard PCR was performed using GoldStar Taq DNA Polymerase (CWBIO, Beijing, China) according to the manufacturer’s instructions. The primers sequences were shown in Table 1. PCR conditions were set up as follows: 94 °C for 2 min, then the following three steps for 34 cycles (94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min), and a final step of cooling to 4 °C. PCR products were run on a 1.7% agarose gel and visualized under UV light using ethidium bromide staining. qRT-PCR was performed on a Corbett Rotor-Gene 6600 QPCR system machine using TransScript™ Green qRT-PCR SuperMix (TRANSGENE BIOTECH, Beijing, China) according to manufacturer’s instructions. The sequences of gene-specific primers were 5′TCACAGGGCCTTAACTTACAC3′ (forward) and 5′GGAGCAAGAATTGGTTTGTCC3′ (reverse) for PDE3A, and 5′GCAAGAGAGAGGCCCTCAG3′ (forward) and 5′TGTGAGGGAGATGCTCAGTG3′ (reverse) for GAPDH. Amplifications were performed with a 10 min template denaturation step at 95 °C, Page 2 of 7 Table 1 The primer sequences of PDE isoforms Name Sequences PDE1A (Forward, F) 5′CCACTTTGTGATCGGAAGTC3′ PDE1A (Reverse, R) 5′TTCTGCTGAATGATGTCCACC3′ PDE1B (F) 5′CAGGGTGACAAGGAGGCAGAG3′ PDE1B (R) 5′GACATCTGGTTGGTGATGC (...truncated)