Oct-4 controls cell-cycle progression of embryonic stem cells.

www.biochemj.org Biochem. J. (2010) 426, 171–181 (Printed in Great Britain) 171 doi:10.1042/BJ20091439 Oct-4 controls cell-cycle progression of embryonic stem cells Jungwoon LEE*, Yeorim GO*, Inyoung KANG*, Yong-Mahn HAN† and Jungho KIM*1 Mouse and human ES (embryonic stem) cells display unusual proliferative properties and can produce pluripotent stem cells indefinitely. Both processes might be important for maintaining the ‘stemness’ of ES cells; however, little is known about how the cell-cycle fate is regulated in ES cells. Oct-4, a master switch of pluripotency, plays an important role in maintaining the pluripotent state of ES cells and may prevent the expression of genes activated during differentiation. Using ZHBTc4 ES cells, we have investigated the effect of Oct-4 on ES cell-cycle control, and we found that Oct-4 down-regulation in ES cells inhibits proliferation by blocking cell-cycle progression in G0 /G1 . Deletion analysis of the functional domains of Oct-4 indicates that the overall integrity of the Oct-4 functional domains is important for the stimulation of S-phase entry. We also show in the present study that the p21 gene is a target for Oct-4 repression. Furthermore, p21 protein levels were repressed by Oct-4 and were induced by the down-regulation of Oct-4 in ZHBTc4 ES cells. Therefore the down-regulation of p21 by Oct-4 may contribute to the maintenance of ES cell proliferation. INTRODUCTION during differentiation by regulating cells that have pluripotent potential, or can develop such potential, unfortunately no Oct-4 target gene involved in ES cell-cycle regulation has been identified. As a first step towards investigating how the oct-4 gene product contributes to the cell-cycle regulation of ES cells, we analysed its potential to regulate the process of self-renewal and control the cell cycle. We found that down-regulation of oct-4 expression led to the growth arrest of ES cells by blocking cellcycle progression in G0 /G1 . Deletion analysis of the functional domains of Oct-4 indicated that the overall integrity of the Oct-4 functional domains is important for the stimulation of S-phase entry. We also show in the present study that a CDKI [CDK (cyclin-dependent kinase) inhibitor] gene, p21, is a target for repression by Oct-4. Furthermore, an increase in p21 protein levels was induced by the down-regulation of oct-4 gene expression in ZHBTc4 ES cells. Therefore the down-regulation of p21 by Oct-4 may contribute to the maintenance of ES cell proliferation. Mouse and human ES (embryonic stem) cells display unusual proliferative properties, which are achieved by symmetric cell division, while maintaining their pluripotency. These properties can be regulated by transcriptional control in the nucleus through extracellular signals [1]. The oct-4 gene, also referred to as oct-3 and oct-3/4, encodes a nuclear protein that belongs to a family of transcription factors containing the POU DNA-binding domain [2–7]. Oct-4 is normally expressed in the pluripotent stem cells of pregastrulation embryos, including oocytes, early-cleavagestage embryos and the ICM (inner cell mass) of the blastocyst [3,4,8,9]. Its expression is down-regulated during differentiation, and knockout of oct-4 causes early lethality in mice due to the absence of an ICM [10]. These results suggest that Oct-4 plays a pivotal role in mammalian development [11] and in the selfrenewal of ES cells [12]. During human development, Oct-4 is expressed at least until the blastocyst stage in which it regulates gene expression [13]. Transcriptional regulation by Oct-4 is complex. In ES cells, the octamer sequence motif (5 -ATGCAAAT-3 ) is active irrespective of its distance from the site of transcriptional initiation [2,14]. However, in differentiated cells, Oct-4 can transactivate its targets only when the octamer motif is in a proximal position [3,15,16]. If the octamer motif is at a distal site, the protein requires stem-cellspecific bridging factors that link it to the transcription initiation site [15]. A number of factors such as Sox2, HMG (high-mobility group), E7, E1A and EWS are known to influence the ability of Oct-4 to act as an activator or repressor [15,17–21]. In addition, the physical association of Oct-4 with PKM2 (pyruvate kinase isozyme type M2) was documented recently, suggesting that PKM2 may also play a role in regulating Oct-4 [22]. Proliferation of ES cells is achieved through self-renewal, and should be regulated by controlling the cell cycle. In comparison with self-renewal, little is known about the cell-cycle regulation of ES cells by Oct-4. Although Oct-4 functions as a master switch Key words: cell-cycle control, differentiation, enbryonic stem cell, G1 cell-cycle arrest, Oct-4, p21, self-renewal. MATERIALS AND METHODS Materials and general methods Restriction endonucleases, calf intestinal AP (alkaline phosphatase), the Klenow fragment of DNA polymerase I and T4 DNA ligase were purchased from New England Biolabs. [α-32 P]dCTP 3000 (Ci/mmol) was obtained from PerkinElmer. Preparation of plasmid DNA, restriction enzyme digestion, agarose gel electrophoresis of DNA, DNA ligation, bacterial transformations and SDS/PAGE of proteins were carried out using standard methods [23]. Constructs The EGFP [enhanced GFP (green fluorescent protein)]-fusion Oct-4 plasmids, pCAG-IP/FLAG-Oct-4–EGFP, pCAG-IP/ FLAG-Oct-4(C)–EGFP, pCAG-IP/FLAG-Oct-4(N)–EGFP, pCAG-IP/FLAG-Oct-4(POU)–EGFP and pCAG-IP/EGFP, were Abbreviations used: AP, alkaline phosphatase; CDK, cyclin-dependent kinase; CDKI, CDK inhibitor; ES, embryonic stem; GAPDH, glyceraldehyde-3phosphate dehydrogenase; GFP, green fluorescent protein; EGFP, enhanced GFP; HEK, human embryonic kidney; ICM, inner cell mass; PI, propidium iodide; PKM2, pyruvate kinase isozyme type M2; RT, reverse transcription. 1 To whom correspondence should be addressed (email ). © 2010 The Author(s)  c The Authors Journal compilation  c 2010 Biochemical Society The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/) which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited. Biochemical Journal *Laboratory of Molecular and Cellular Biology, Department of Life Science, Sogang University, Seoul 121-742, Republic of Korea, and †Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 305-701, Republic of Korea 172 J. Lee and others generated through the following steps. For pCAG-IP/FLAGOct-4–EGFP, the Oct-4 cDNA was amplified from pcDNA3/Oct-4 [17] using PCR with the primers 5 -Oct4 (2) (5 - GATCGGATCCCGCTGGACACCTGGCTTC3 , a BamHI site is underlined) and 3 -Oct-4 (352) (5 GATCGAATTCGGTTTGAATGCATGGGAG-3 , an EcoRI site is underlined), digested with BamHI and EcoRI, and cloned into the same (...truncated)