Author Correction: Strategies to Mitigate Variability in Engineering Human Nasal Cartilage

Mar 2020

Stephen H. J. Andrews, Melanie Kunze, Aillette Mulet-Sierra, Lynn Williams, Khalid Ansari, Martin Osswald, Adetola B. Adesida

Article PDF cannot be displayed. You can download it here:

https://www.nature.com/articles/s41598-019-53740-y.pdf

Author Correction: Strategies to Mitigate Variability in Engineering Human Nasal Cartilage

www.nature.com/scientificreports OPEN Published: xx xx xxxx Author Correction: Strategies to Mitigate Variability in Engineering Human Nasal Cartilage Stephen H. J. Andrews , Melanie Kunze, Aillette Mulet-Sierra, Lynn Williams, Khalid Ansari, Martin Osswald & Adetola B. Adesida Correction to: Scientific Reports https://doi.org/10.1038/s41598-017-06666-2, published online 26 July 2017 This Article contains errors in Table 1 where the RT-qPCR Primer Sequences for the following genes, FGFR2, FGFR3 & FGFR4 are incorrect. The table with the corrected gene sequences is included below. Scientific Reports | (2019) 9:17115 | https://doi.org/10.1038/s41598-019-53740-y 1 www.nature.com/scientificreports www.nature.com/scientificreports/ Gene Accession # Forward Reverse ACAN M_55172 AGGGCGAGTGGAATGATGTT GGTGGCTGTGCCCTTTTTAC COL1A2 NM_000089 TTG CCC AAA GTT GTC CTC TTC T AGC TTC TGT GGA ACC ATG GAA COL2A1 NM_033150 CTG CAA AAT AAA ATC TCG GTG TTC T GGG CAT TTG ACT CAC ACC AGT COL10A1 X60382 GAAGTTATAATTTACACTGAGGGTTTCAAA GAGGCACAGCTTAAAAGTTTTAAACA SOX9 Z46629 CTTTGGTTTGTGTTCGTGTTTTG AGAGAAAGAAAAAGGGAAAGGTAAGTTT YWHAZ NM_003406 TCTGTCTTGTCACCAACCATTCTT TCATGCGGCCTTTTTCCA HOXC4 NM_014620.5 ACCGTCGCATGAAATGGAA TGCTGACCTGACTTTGGTGTTG HOXC5 NM_018953.3 GGTGCAGGCATCCAGGTACT CGGTGGGAAAGTGATGCTTAA HOXC8 NM_022658.3 AACCCGTGCTCGCTTAGCT GCCTCGTAGCCATAGAATTTGG HOXD3 NM_006898.4 GGAGCTTCCTGAGTGCACAAT CCTCCAAACAGTCCTGGGTTT HOXD8 NM_019558.3 GGAATTTCTTTTTAACCCCTATCTGA GCTAGGGCGTGGGAAACC FGFR1 NM_023110.2 AACCTGACCACAGAATTGGAGGCT ATGCTGCCGTACTCATTCTCCACA FGFR2 NM_000141.4 TGCACAAGCTGACCAAACGT CTGGACTCAGCCGAAACTGTT FGFR3 NM_000142.4 GCGCCTGAGGCCTTGTTT CCAAAGGACCAGACGTCACTCT FGFR4 NM_002011.4 ACCCCACGCCCACCAT TGCGGTTCTCCCCATGAA Table 1. RT-qPCR Primer Sequences. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. © The Author(s) 2019 Scientific Reports | (2019) 9:17115 | https://doi.org/10.1038/s41598-019-53740-y 2 (...truncated)


This is a preview of a remote PDF: https://www.nature.com/articles/s41598-019-53740-y.pdf
Article home page: https://www.nature.com/articles/s41598-019-53740-y

Stephen H. J. Andrews, Melanie Kunze, Aillette Mulet-Sierra, Lynn Williams, Khalid Ansari, Martin Osswald, Adetola B. Adesida. Author Correction: Strategies to Mitigate Variability in Engineering Human Nasal Cartilage, DOI: 10.1038/s41598-019-53740-y