Primary cells from patients with adult T cell leukemia/lymphoma depend on HTLV-1 Tax expression for NF-κB activation and survival

Blood Cancer Journal ARTICLE www.nature.com/bcj OPEN Primary cells from patients with adult T cell leukemia/ lymphoma depend on HTLV-1 Tax expression for NF-κB activation and survival Rita Hleihel1,2, Hala Skayneh1,2, Hugues de Thé3,4,5, Olivier Hermine6,7 and Ali Bazarbachi 1,2 ✉ 1234567890();,: © The Author(s) 2023 Adult T cell leukemia/lymphoma (ATL) is an aggressive malignancy secondary to chronic infection with human T cell leukemia virus type 1 (HTLV-1). The viral oncoprotein Tax initiates T cell transformation through activation of critical cellular pathways, including NF-κB. Unexpectedly, Tax protein is not detectable in most ATL cells, in contrast to the HTLV-1 HBZ protein which antagonizes Tax effects. Here, we demonstrate that primary ATL cells from patients with acute or chronic ATL express very low levels of Tax mRNA and protein. Critically, survival of these primary ATL cells is dependent on continued Tax expression. Mechanistically, Tax extinction results in reversal of NF-κB activation, P53/PML activation and apoptosis. Tax drives interleukin-10 (IL-10) expression and recombinant IL-10 rescues the survival of tax-depleted primary ATL cells. These results demonstrate the critical role of continued Tax and IL-10 expression for the survival of primary ATL cells, highlighting their relevance as therapeutic targets. Blood Cancer Journal (2023)13:67 ; https://doi.org/10.1038/s41408-023-00841-7 INTRODUCTION Adult T cell leukemia/lymphoma (ATL) is a rare blood malignancy carrying a dismal prognosis [1], which is secondary to chronic infection with the human T cell leukemia virus type 1 (HTLV-1) [2]. HTLV-1 infects 10–20 million individuals worldwide [3], of which around 5% develop ATL after a long latency period exceeding several decades [3]. ATL development is preceded by oligoclonal expansion of some HTLV-1 infected cells, driven by expression of the viral oncoprotein Tax [4]. Tax is a multifaceted oncoprotein playing pleiotropic functions in ATL leukemogenesis [5–7]. Tax is a transcriptional activator initiating transcription of HTLV-1 mRNAs from the 5’LTR promoter [8]. Tax also alters expression of several cellular genes and interacts with essential signaling pathways imperative for cellular transformation [5, 7–12]. At early stages of HTLV-1 infection, Tax-mediates the constitutive activation of NF-κB, paramount for the proliferation and survival of infected T cells [5, 9]. Tax connects to the IKK kinase complex, resulting in IκBα phosphorylation ubiquitination, and proteasomal degradation, ultimately activating NF-κB, a key regulator of T lymphocytes growth [8–10, 13–16]. Tax oncogenic capacity is well documented, as its sole expression transforms T cells in vitro, and induces leukemia in transgenic mice or flies [17–23]. While the role of Tax in initiating ATL development is well established, its role in maintaining the leukemic phenotype is contentious. Indeed, Tax transcript and protein are not detected in most ATL cells [24–26]. However, primary ATL cells exhibit many properties of Tax-expressing cells, particularly constitutive NF-κB activation [27], proposed to result from mutations targeting the T-cell receptor and the NF-κB pathways [28, 29]. Nevertheless, some indications suggest a role of Tax in the maintenance of the leukemic phenotype in vivo. Transient bursts of Tax expression occur in small fractions of HTLV-1 infected cells or the ATL-derived cell line MT-1 [30, 31]. Anti-Tax antibodies and Tax-specific cytotoxic T lymphocytes were reported in ATL patients [32, 33]. Injection of ATL cells in animals led to the development of Tax-specific CTL [34, 35], while a Tax peptidepulsed dendritic cell vaccine showed some efficacy in treating Taxpositive ATL patients [36]. Finally, treatment with arsenic trioxide (ATO) and interferon-alpha (IFN), which induce Tax proteasomal degradation, resulted in selective cell death of ATL cells and ensured long-lasting responses in ATL patients [17, 37–42]. HBZ, encoded by the complementary strand of HTLV-1 [43], is constantly expressed in asymptomatic carriers or ATL patients [44]. HBZ decreases Tax expression [45] and inhibits NF-κB activity [46] to counterbalance Tax-induced hyperactivation of NF-κB and preclude senescence [47, 48]. Accordingly, HBZ overexpression in tax-transgenic flies rescues Tax-induced cellular transformation [49] providing a direct in vivo evidence for antagonistic roles between Tax and HBZ. High levels of interleukin-10 (IL-10), an immunosuppressive cytokine modulated by both Tax and HBZ, were reported in ATL patients [38, 50, 51]. IL-10 is an immunosuppressive NF-κB target which enhances the proliferation of HTLV-1-infected cells [52]. 1 Department of Internal Medicine, Faculty of Medicine, American University of Beirut, Beirut, Lebanon. 2Department of Anatomy, Cell Biology and Physiological Sciences, Faculty of Medicine, American University of Beirut, Beirut, Lebanon. 3INSERM UMR 944, CNRS UMR 7212, Institut Universitaire d’Hématologie, Université Paris-Cité, Hôpital St. Louis 1, Paris, France. 4Service d’Hématologie, Assistance Publique, Hôpital St. Louis 1, Paris, France. 5College de France, PSL research University, Paris, France. 6Institut Imagine—INSERM U1163, Necker Hospital, University of Paris, Paris, France. 7Department of Hematology, Necker Hospital, University of Paris, Assistance Publique Hôpitaux de Paris, Paris, France. ✉email: Received: 1 March 2023 Revised: 13 April 2023 Accepted: 19 April 2023 R. Hleihel et al. 2 Anti-viral therapies of ATL decrease IL-10 levels in mice and patients [38, 42], restoring innate immunity [42]. Here, we demonstrate that the survival of primary ATL cells from patients is dependent on Tax expression and identify IL-10 as a key downstream target. These results strengthen the concept of ATL as Tax-dependent malignancy highlighting its role as a key therapeutic target. METHODS Cell lines and primary ATL cells HTLV-1 transformed and ATL-derived cell lines (HuT-102, MT-1; gift from K. Ishitsuka)) and HTLV-1-negative cells (CEM, Jurkat) were maintained in RPMI medium supplemented with 10% fetal bovine serum (FBS; SigmaAldrich; Germany) and antibiotics. Blood was collected from two healthy donors, three patients with chronic ATL and three patients with acute ATL after informed consent in accordance with the declaration of Helsinki. This study was approved by the institutional review board of the American University of Beirut. Peripheral blood mononuclear cells (PBMC) were separated using Ficoll and cultured in RPMI supplemented with 10% FBS and antibiotics. Short hairpin RNA (shRNA) Cells were transduced with murine stem cell virus green fluorescent protein (GFP)-lentiviral vectors encoding scrambled (SCR) short hairpin RNA (shRNA) or shRNA against Tax (sh-Tax (1): CAGGCCTTATTTGGACATTTA, shTax (2): CTCAGCTCTACAGTTCCTTAT) or shRNA against HBZ (kindly provided by M. Matsuoka) [53]. Lentiviruses were produced by transient transfection of (...truncated)