A high-throughput assay for Tn5 Tnp-induced DNA cleavage

Brandon Ason 0 William S. Reznikoff 0 0 Department of Biochemistry, University of Wisconsin-Madison , 433 Babcock Drive, Madison, WI 53706, USA Transposition causes genomic instability by mobilizing DNA elements. This phenomenon is mechanistically related to other DNA rearrangements, such as V(D)J recombination and retroviral DNA integration. A conserved active site architecture within the transposase/integrase superfamily catalyzes these distinct phenomena. The Tn5 transposase (Tnp) falls within this protein class, and many intermediates of the Tn5 transposition reaction have been characterized. Here, we describe a method for the rapid identification of Tn5 Tnp small molecule effectors. This high-throughput screening strategy will aid in the identification of compounds that perturb Tnp-induced DNA cleavage. This method is advantageous, since it identifies effectors that specifically inhibit catalysis without inhibiting Tnp-DNA binding interactions. Effectors identified using this method will serve as a valuable aid both in the isolation and characterization of metal-bound reaction intermediates and in co-crystallization studies involving the effector, Tnp and DNA, to identify the structural basis of the interaction. Furthermore, since Tn5 Tnp shares a similar active site architecture to other transposase/integrase superfamily members, this strategy and any effectors identified using this method will be readily applicable to these other systems. - A variety of mechanisms for mobilizing DNA elements have evolved, differing both in the number of proteins and in the mechanism required to carry out these rearrangements (1). The cleavage mechanism can range from double-strand breaks, in the case of Tn5, to strand nicking and 30 end processing. Although the nature of strand cleavage varies, all members of the transposase/integrase superfamily use a conserved active site geometry to carry out these DNA processing reactions (29). The catalytic core within this protein family contains three acidic amino acid residues, known as the DDE motif (10). The spatial location of these residues within the active site of each protein is surprisingly close to one another, as observed by the overlay of the Tn5 transposase (Tnp) and ASV integrase structures (11). The DDE residues are responsible for the divalent metal coordination required for catalysis. These residues generate nucleophilic water molecules within the active site that nick the DNA strand. In the case of Tn5 Tnp, the 30 hydroxyl group generated by the initial nick in turn acts as the nucleophile to attack the complementary DNA strand generating a hairpin. The DNA hairpin is subsequently resolved through an attack by an additional activated water molecule to form a doublestrand break in the DNA releasing the transposon from the donor site. Following strand cleavage, the two Tnp proteins tether the transposon end sequences to a third DNA molecule containing a target site for transposon insertion. Strand transfer subsequently occurs, and, in the case of Tn5, generates a 9 bp duplication, which flanks the newly inserted transposon (12). Mechanistic probes would serve as a useful tool to probe many of these reaction intermediates, as conformational differences exist between TnpDNA intermediates and presumably metal bound and free complexes (6,11,13,14). Here, we describe a method for the rapid identification of Tn5 Tnp strand cleavage effectors. This method is based on the change in fluorescence polarization (FP) of a selectively labeled DNA fragment. In this assay, a change in FP accompanies the release of the labeled DNA fragment following strand cleavage. This method is readily transferable to robotic manipulation, since there are no wash steps, only a limited the number of fluid transfer steps, and requires a minimal sample volume. In addition, this assay is well suited for use in studying other transposase/integrase systems, such as HIV-1 integration or RAG-mediated V(D)J cleavage. Thus, effectors identified using this method may serve both as mechanistic probes and as potential leads in drug discovery. MATERIALS AND METHODS The short oligonucleotides used for these experiments were purchased from Integrated DNA Technology (IDT). The short oligonucleotides were annealed to form double-stranded DNA (dsDNA) by adding 2 mmol of each oligonucleotide to a 20 mM TrisHCl, pH 7.9, 10 mM NaCl solution for a 2 mM final oligonucleotide concentration. To anneal the single-stranded DNA (ssDNA), the oligonucleotides were heated at 96 C for 1 min followed by a decrease in temperature at the rate of 0.1 C/s to 4 C. The transferred strand is labeled with rhodamine green for the FP assays or fluorescein for native gel-shift assays. Fluorescent oligonucleotides were purifed using high-performance liquid chromatography and were obtained from IDT. The sequences of the 50 nt DNA fragments used for FP assays are 50-TGCAGGTCGACTGTCTCTTATACACATCTTGAGTGAGTGAGCATGCATGT-30 and its complement. The dsDNA produced from these two fragments consists of 10 bp of donor and 40 bp of transposon DNA. Only the 50 end of the non-transferred strand is fluorescently labeled for the experiments using this dsDNA substrate. The sequences of the 60 nt DNA fragments used for the gel-shift assays are 50GGCCACGACACGCTCCCGCGCTGTCTCTTATACACATCTTGAGTGAGTGAGCATGCAGT-30 and its complement. The dsDNA produced from these two fragments consists of 20 bp of donor and 40 bp of transposon DNA, which are both labeled with fluorescein on their 50 ends. Transposase purification The EK54, MA56 and LP372 hyperactive mutant version of Tnp is used for all assays and will be referred to as Tnp throughout this paper. Tnp was purified as described previously (15). All Tnp protein preparations were quantified using a Bradford assay with BSA as the standard. Strand cleavage assays In these assays, two DNA fragments each containing the Tnp recognition sequence were used to mimic the Tn5 transposon. The cleavage reactions were carried out by incubating 800 nM Tnp with 160 nM dsDNA at 37 C for 1.5 h in cleavage buffer (25 mM Hepes, pH 7.5, 2 mM TrisHCl pH 7.5, 100 mM potassium glutamate, 9 mM NaCl, 0.5 mM 2-mercaptoethanol, 10 mg/ml t-RNA, 0.25 mg/ml BSA, 9% glycerol and 10 mM magnesium acetate). For FP analysis, the 60 ml reactions were analyzed using the FP protocol on a Wallac Victor V plate reader with the instruments fluorescein filters, F485 excitation and F535 emission. The readings were taken 8 mm from the bottom of the plate with the G factor set at 1 and a 0.1 s counting time. The polarization aperture is set at normal and the CW-lamp energy is set at the maximum, 65 535. For gel-shift assays, after incubation at 37 C, a 20 ml aliquot of each reaction is mixed with 6 ml of 6 loading dye (Promega) and electrophoresed on either 9 or 10% native polyacrylamide gel at 300 V. After 3 h, the gel is scanned using a FluorImager SI (Vistra Fluorescence), and the bands are quantified (...truncated)