Site‐specific incorporation of an unnatural amino acid into proteins in mammalian cells

Kensaku Sakamoto 2 Akiko Hayashi 1 Ayako Sakamoto 0 Daisuke Kiga 0 1 Hiroshi Nakayama 3 Akiko Soma 1 Takatsugu Kobayashi 2 Makoto Kitabatake 0 Koji Takio 3 Kazuki Saito 0 1 Mikako Shirouzu 0 Ichiro Hirao 1 Shigeyuki Yokoyama 0 1 2 0 RIKEN Genomic Sciences Center , 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045, Japan 1 Yokoyama CytoLogic Project, Exploratory Research for Advanced Technology (ERATO), Japan Science and Technology Corporation (JST) , 4-1-8 Hou-cho, Kawaguchi-shi, Saitama 332-0012, Japan 2 Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo , 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan 3 Biomolecular Characterization Division , RIKEN, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan A suppressor tRNATyr and mutant tyrosyl-tRNA synthetase (TyrRS) pair was developed to incorporate 3-iodo-L-tyrosine into proteins in mammalian cells. First, the Escherichia coli suppressor tRNATyr gene was mutated, at three positions in the D arm, to generate the internal promoter for expression. However, this tRNA, together with the cognate TyrRS, failed to exhibit suppressor activity in mammalian cells. Then, we found that amber suppression can occur with the heterologous pair of E.coli TyrRS and Bacillus stearothermophilus suppressor tRNATyr, which naturally contains the promoter sequence. Furthermore, the efficiency of this suppression was significantly improved when the suppressor tRNA was expressed from a gene cluster, in which the tRNA gene was tandemly repeated nine times in the same direction. For incorporation of 3-iodo-L-tyrosine, its specific E.coli TyrRS variant, TyrRS(V37C195), which we recently created, was expressed in mammalian cells, together with the B.stearothermophilus suppressor tRNATyr, while 3-iodo-L-tyrosine was supplied in the growth medium. 3-Iodo-L-tyrosine was thus incorporated into the proteins at amber positions, with an occupancy of >95%. Finally, we demonstrated conditional 3-iodo-L-tyrosine incorporation, regulated by inducible expression of the TyrRS(V37C195) gene from a tetracycline-regulated promoter. - The incorporation of unnatural chemical groups into proteins has increasing importance in protein science and cell biology. Biophysical probes or structural modifications have been introduced into proteins by chemical modifications of amino acid residues (1) or by semi-synthetic methods involving protein ligations (2). The biosynthesis of proteins containing unnatural amino acids, alloproteins (3), is also a promising way of expanding the structural and chemical diversity in proteins (311). The site-specific incorporation of unnatural amino acids has been employed to study membrane proteins expressed in Xenopus oocytes (6,7). The utility of sitespecific alloproteins for regulating the interactions between cell signaling proteins has been shown in experiments in vitro (12). However, the only eukaryotic in vivo system available for alloprotein synthesis has been confined to Xenopus oocytes, which has severely limited the yields of alloproteins (7). The availability of alloproteins in mammalian cells should be extended for further applications in cell biology. Unnatural amino acids have been attached to the specific adaptor tRNAs corresponding to amber codons (4,10,11), four base codons (13) or artificial codons with unnatural bases (14,15). One approach for site-specific-alloprotein synthesis involves the synthesis of the aminoacylated forms of the tRNAs, by chemical acylation (16) or by using an aminoacyltRNA synthetase (aaRS) (8,15), before their use in alloprotein synthesis. The adaptor tRNA cannot be reacylated during translation without the specific aaRS for the unnatural amino acid. The use of the tRNA in the aminoacylated form is prohibitive to the large-scale synthesis of alloproteins in vitro or in vivo, or to the conditional incorporation of unnatural amino acids regulated by certain signals, such as a signal for the expression of the specific tRNA and/or aaRS. Another approach involves the use of specific tRNAaaRS pairs for the unnatural amino acids, allowing the reacylation of the tRNA. Wang et al. have created two variants of Methanococcus jannaschii tyrosyl-tRNA synthetase (TyrRS) that are highly specific to O-methyl-L-tyrosine (17) and L-3(2-naphthyl)alanine (18). When these amino acids were supplied in the growth medium, they were actually incorporated at amber positions by these variant enzymes and the cognate suppressor tRNATyr in Escherichia coli cells. The M.jannaschii TyrRS does not recognize E.coli tRNAs, while the E.coli aaRSs do not recognize the suppressor tRNATyr (17). Thus, this archaebacterial tRNATyrTyrRS pair is orthogonal to the E.coli translation system. To extend this approach to eukaryotic systems, we recently created a 3-iodo-L-tyrosine-specific variant of E.coli TyrRS, with the two amino acid replacements Y37V and Q195C (19). This variant enzyme, TyrRS(V37C195), together with the E.coli suppressor tRNATyr, incorporates 3-iodo-L-tyrosine at amber positions in a wheatgerm cell-free translation (19). To use this system in a mammalian cell, the E.coli TyrRS and the cognate suppressor tRNATyr should be expressed and functional in the cell. The pair of a suppressor tRNAGln and glutaminyl-tRNA synthetase (GlnRS) from E.coli, which is orthogonal to the eukaryotic translation system, has been expressed in mammalian cells and caused amber suppression (20). The cytidine at position 9 (C9) in this tRNA was replaced by A to generate the internal promoter for expression in mammalian cells. On the other hand, the corresponding engineering for the E.coli tRNATyr would require three base substitutions in the positions involved in the tertiary interactions that support the L-shaped structure, which could impair tRNA function. This difficulty has been circumvented by importing the aminoacylated form of this suppressor tRNATyr, with no such substitutions, into mammalian cells (21). In the present study, the Bacillus stearothermophilus suppressor tRNATyr was expressed in mammalian cells together with E.coli TyrRS(V37C195), for the incorporation of 3-iodo-L-tyrosine into proteins (Fig. 1); the Bacillus tRNATyr contains the internal promoters in its native sequence (Fig. 2), and can be recognized by E.coli TyrRS (22). Finally, we created a cell line that stably maintains this variant TyrRS gene expressed from a tetracycline-regulated promoter, for conditional incorporation of 3-iodo-L-tyrosine in the presence of this inducer. MATERIALS AND METHODS tRNA genes for the expression in mammalian cells The human, E.coli and B.stearothermophilus suppressor tRNATyr genes were constructed by annealing two oligodeoxynucleotides, commercially synthesized by Amersham Pharmacia Biotech; each gene consists of the corresponding tRNA sequence, lacking the 3-CCA, and the 5-flanking sequence (AGCGCTCCGGTTTTTCTGTGCTGAACCTCAGGGGACGCCGACACACGTACACGTC) of the human tRNATyr gene (23), linked to the 5 end (...truncated)