Immobilized Metal Affinity Chromatography of DNA

Changhee Min 0 Gregory L. Verdine 0 0 Department of Chemistry, Harvard University , Cambridge, MA 02138, USA Many of the most widely employed operations in molecular biology hinge upon the use of singlestranded DNA as a probe or template. Here we report a straightforward method by which to produce long singlestranded DNA molecules using the polymerase chain reaction (PCR) in combination with immobilized metal affinity chromatography (IMAC). We demonstrate that a tag consisting of six successive 6-histaminylpurine (H) residues (H6-tag) endows a DNA strand with selective retentivity onto a Ni2+-NTA-agarose chromatography matrix. The H6-tagged strand can then be eluted from the resin using 200 mM imidazole. Quantitative phosphorimaging analysis revealed that the PCR/IMAC procedure typically yields unmodified strands comprising >90% of the unbound DNA and H6-tagged strands comprising >95% of the bound fractions. DNA strands generated in this manner are shown to be excellent substrates for template-directed polymerization. The chemistry reported herein should facilitate a wide variety of operations in molecular biology, including automated DNA sequencing, hybridization screening of DNA libraries, assembly of gene cassettes, run-off transcription, site-directed mutagenesis and footprinting of protein-DNA complexes by template-directed interference footprinting. - Many of the most widely employed operations in molecular biology hinge upon the use of single-stranded DNA as a probe or template (1). Whereas single strands of DNA containing up to ~ 100 residues can readily be produced by solid-phase synthesis, longer oligodeoxynucleotides must be generated through enzymatic methods such as the polymerase chain reaction (PCR) (24). Biochemical procedures for the synthesis of mixed-sequence DNA yield double-stranded products. One exception is the so-called asymmetric PCR procedure (58) in which one PCR primer is used in large excess over the other. Under these conditions, the exponential phase of PCR amplification proceeds until the supply of limiting primer is exhausted by the production of duplex DNA; after this, the primer present in excess supports linear amplification of only the strand emanating from it. We and others have used asymmetric PCR with success; however, in our hands (68) the method produces highly variable yields of single-stranded product, even in parallel reactions aliquoted from the same master * To whom correspondence should be addressed reaction mixture. The yields of duplex DNA obtained via asymmetric PCR reactions, on the other hand, are less variable. An affinity based procedure that employs the binding of biotin-labeled oligonucleotides to streptavidin-linked beads has also been employed in strand separation (9,10), but invariably one strand is lost to the beads and the procedure is incompatible with strongly denaturing conditions. Thus there exists the need for a truly general method by which to resolve double-stranded PCR products into its constituent strands. Such resolution is rendered difficult by the similarities in macroscopic physical properties such as size and charge of the two complementary strands, and by the requirement that it be carried out in the presence of strong denaturants such as urea or guanidinium hydrochloride. Here we report the development of a highly effective, operationally straightforward method for resolving duplex DNA into its constituent strands, using immobilized metal affinity chromatography (IMAC; 11). MATERIALS AND METHODS Synthesis and purification of H6-tagged oligonucleotides The H6-tagged oligonucleotides were synthesized by the convertible nucleoside approach (1215) using the O6-phenyl-2-deoxyinosine (f dI) phosphoramidite (16,17) along with PAC phosphoramidites (Pharmacia). The resin-bound oligonucleotide 5-d[G(f I)6AGCGGATAACAATTTCACACAGG] and 5-d[G(f I)6TCGTGACTGGGAAAACCCTGGCG] were deprotected by treatment with 1 ml concentrated (14 M) aqueous ammonium hydroxide at room temperature for 4 h and lyophilized to dryness on a Speed Vac (Savant). The DNA pellets were redissolved in 100 m l 5 M aqueous histamine and incubated at 55 C for 14 h. After cooling to room temperature, 300 m l absolute ethanol (kept at 20 C) was added, the mixture was chilled on crushed solid CO2 for 30 min, then centrifuged at 16 000 g for 30 min. The supernatants were discarded and the pellets washed with 200 ml 80% (v/v) aqueous ethanol solution (20 C). The pellets were dried on a Speed Vac, redissolved in 200 m l formamide loading buffer (95% aqueous formamide, 20 mM EDTA, 0.05% each bromophenol blue and xylene cyanol), heated to 90 C for 5 min, then loaded onto a 20% (19:1 acrylamide:bis) polyacrylamide gel (20 20 cm) containing 7 M urea. The gels were pre-run at 300500 V in TBE buffer (90 mM Tris-borate, 2 mM EDTA, pH 8) for at least 1 h prior to loading the DNA. Following electrophoresis, the gel was removed from the glass plates, enclosed in Saran Wrap and placed over a TLC plate impregnated with fluorescent dye. The full-length DNA band was visualized using a hand-held UV lamp, excised from the gel with a sharp razor blade, placed in a 50 ml Falcon tube and crushed thoroughly using the polished end of a glass stirring rod. The crushed gel was soaked overnight at 37 C in 10 ml 1 M triethylammonium bicarbonate (TEAB), pH 8.0. The supernatant was transferred to a new Falcon tube, and the crushed polyacrylamide was further extracted once with 5 ml 1 M TEAB. The combined TEAB solutions were loaded onto a C18 Sep-Pak cartridge (Waters), which had bee pre-washed by successive throughput of 5 ml 100% CH3CN and 15 ml 50 mM TEAB. Following loading of the DNA, the Sep-Pak was washed with 2 ml 5% CH3CN/95% 50 mM TEAB and eluted with 10 ml 30% CH3CN/70% 50 mM TEAB into 1.5 ml Eppendorf tubes. The fractions were assayed by UV spectrophotometry, and those that contained a significant A260 were lyophilized to dryness in a SpeedVac. The lyophilized DNA pellets was combined in 50m l TE buffer to generate an oligonucleotide stock solution that was used directly in subsequent experiments. This procedure typically yields ~ 150 nmol highly purified H6-tagged oligonucleotide using a 200 nmol resin; comparable yields were obtained for untagged oligonucleotides purified by the same procedure. We have not investigated purification of the crude H6-tagged oligonucleotides using Ni2+-NTA chromatography, but this should work and would be sufficient for most applications. Nucleoside composition analysis The oligonucleotide sample (3 nmol) was digested with 0.2 U snake venom phosphodiesterase (Pharmacia) and 50 U Serratia endonuclease (Benzonase, Merck) in 50 m l buffer containing 100 mM NaCl, 14 mM MgCl2, 100 mM TrisHCl, pH 9.0 at room temperature for 2 h, then at 37 C for 2 h. The buffer was adjusted to 100 m l 0.1 mM ZnCl2, 50 mM NaCl, 17 mM MgCl2, 200 mM, 10 mM b -mercaptoethanol, 200 mM TrisHCl, pH 9.0, and 1 U calf intestinal alkaline phosphatase (Boe (...truncated)