Lack of sugar discrimination by human Pol µ requires a single glycine residue

Jose F. Ruiz 0 Raquel Jua rez 0 Miguel Garca-Daz 0 Gloria Terrados 0 Angel J. Picher 0 Sergio Gonza lez-Barrera 0 Antonio R. Ferna ndez de Henestrosa 0 Luis Blanco 0 0 Centro de Biologa Molecular Severo Ochoa (CSIC-UAM), Campus de la Universidad Auto noma de Madrid , Cantoblanco, 28049 Madrid, Spain DNA polymerase mu (Pol m) is a novel family X DNA polymerase that has been suggested to play a role in micro-homology mediated joining and repair of double strand breaks. We show here that human Pol m is not able to discriminate against the 2-OH group of the sugar moiety. It inserts rNTPs with an efficiency that is <10-fold lower than that of dNTPs, in sharp contrast with the >1000-fold discrimination characteristic of most DNA-dependent DNA polymerases. The lack of sugar discrimination by Pol m is demonstrated by its ability to add rNTPs to both DNA and RNA primer strands, and to insert both deoxy- and ribonucleotides on growing nucleic acid chains. 3D-modelling of human Pol m based on the available Pol b and TdT structural information allowed us to predict candidate residues involved in sugar discrimination. Thus, a single amino acid substitution in which Gly433 residue of Pol m was mutated to the consensus tyrosine present in Pol b, produced a strong increase in the discrimination against ribonucleotides. The unusual capacity to insert both rNTPs and dNTPs will be discussed in the context of the predicted roles of Pol m in DNA repair. - Traditionally, polymerases have been classified into several classes on the basis of their substrate specificities: usage of DNA and/or RNA as a template and dNTPs or rNTPs as substrates. The two main classes, DNA and RNA polymerases, use DNA as template but differ in their ability to incorporate either dNTPs or rNTPs on nucleic acid chains. Natural DNA-dependent DNA polymerases exhibit high sugar discrimination, selecting dNTPs over rNTPs by several orders of magnitude (13). Based on existing evidence, the ability to discriminate between nucleotide substrates is a consequence of subtle structural differences among DNA polymerases. Thus, single amino acid substitutions introduced in the active site of different DNA polymerases had dramatic effects on the degree of discrimination between the 2-H or -OH group of the sugar moiety, producing mutant DNA polymerases capable of incorporating rNTPs efficiently (2,47). A striking exception to this rule is terminal deoxynucleotidyl transferase (TdT), a DNA polymerase which is not strictly DNA-dependent. TdT contributes to the diversification of antigen receptors by adding non-templated nucleotides to gene segment junctions of Ig and T-cell receptor genes during V(D)J recombination (reviewed in 8). Soon after its isolation, it was shown that TdT could use both rNTPs and dNTPs as nucleotide polymerization substrates (9). These results have been recently re-evaluated, confirming that murine TdT, although having a strong preference for deoxynucleotideterminated over ribonucleotide-terminated primers, is almost incapable of discriminating between rNTPs and dNTPs (10). TdT belongs to the Pol X DNA polymerase family, evolutionarily related to a larger group of nucleotidyltransferases (11,12). Four Pol X family members are expressed in vertebrates: TdT (9) and Pol b (13), both studied earlier, and the recently described Pol l (14) and Pol m (15). While Pol l is structurally and functionally similar to Pol b, Pol m is the closest relative to TdT, showing a 42% amino acid identity (16). Pol m is a recently described DNA polymerase with an intrinsic terminal transferase activity, error-proneness during DNA-dependent DNA synthesis, and specific expression pattern in secondary lymphoid organs in mammals. Moreover, Pol m has the unusual ability to promote transient primertemplate misalignments, which mainly result in frameshift (17) and base substitution (J.F. Ruiz, K. Bebenek, T. Kunkel and L. Blanco, unpublished results) mutations. These data, together with the recently demonstrated interaction with several components of the non-homologous end joining (NHEJ) machinery (18), suggest that Pol m could have an important role in the end-joining pathway for repair of DNA double strand breaks. Moreover, the misalignment capacity of Pol m appears to be crucial to carry out bypass synthesis of certain DNA lesions (19,20). We provide here novel insights into the biochemical characterization of human Pol m, demonstrating its striking ability to incorporate and elongate rNTPs to nucleic acid chains. This unusual capacity mainly relies on a single glycine residue that substitutes for a conserved aromatic residue present in Pol b and in most members of the Pol X family of DNA-dependent DNA polymerases. MATERIALS AND METHODS Unlabelled ultrapure dNTPs and rNTPs and [g-32P]ATP (3000 Ci/mmol) were purchased from Amersham Pharmacia Biotech. Synthetic DNA oligonucleotides were obtained from Invitrogen (P15-DNA, 5 TCTGTGCAGGTTCTT 3; T32DNA (A), 5 TGAAGTCCCTCTCGACAAAGAACCTGCACAGA 3; T32-DNA (C), 5 TGAAGTCCCTCTCGACCAAGAACCTGCACAGA 3; T32-DNA (G), 5 TGAAGTCCCTCTCGACGAAGAACCTGCACAGA 3; T32DNA (T), 5 TGAAGTCCCTCTCGACTAAGAACCTGCACAGA 3; D16-DNA, 5 GTCGAGAGGGACTTCA 3) and RNA oligonucleotide from Genotek (P15-RNA, 5 UCUGUGCAGGUUCUU 3). All the oligonucleotides described above were purified by electrophoresis on 8 M urea, 20% polyacrylamide gels. T4 polynucleotide kinase and T4 DNA ligase were from New England Biolabs. TdT, Taq DNA polymerase and Pfu DNA polymerase were from Promega. Construction and purification of wild-type and mutant forms of human Pol m Human Pol m cDNA was obtained as previously described (15). Site-directed mutations were introduced into a human Pol m overexpression plasmid (pRSETa-hPol m) by a PCRbased method (QuikChange Site-Directed Mutagenesis kit, Stratagene) with the following oligonucleotides: 5 TGCTCGGTTTTACTGGCTCCAAGCT 3 and its reverse complementary oligonucleotide for the W434F mutation; 5 CTTTCGCCCTGCTCGGTGGGACTG 3 and its reverse complementary oligonucleotide for the W434R mutation; 5 TTCGCCCTGCTCTATTGGACTGGCTCC 3 and its reverse complementary oligonucleotide for the G433Y mutation; 5 CTTTCGCCCTGCTCTATTTTACTGGCTCCA 3 and its reverse complementary oligonucleotide for the G433Y/ W434F double mutation. Expression of Pol m variants was carried out in the Escherichia coli strain BL21(DE3)pLysS under standard conditions. Pol m proteins (either wild-type or mutant) were purified to homogeneity as previously described (15). Polymerase activity was evaluated by using synthetic doublestranded oligonucleotides as substrates. These substrates were prepared by annealing a 5-32P-end-labelled primer (DNA or RNA) to different oligonucleotides to generate open (P15/ T32) and gapped (P15/T32/D16) template/primer substrates. In polymerization reactions, the incubation mixture contained, in 12.5 ml, 50 mM TrisHCl, pH 7.5, 2 mM MgCl2 or 1 mM MnCl2, 1 mM DTT, 4% glycerol, 0.1 mg/ml BSA, different concentrations of (...truncated)