Structural analysis of the bipartite DNA-binding domain of Tc3 transposase bound to transposon DNA

Stephan Watkins 0 Gertie van Pouderoyen 0 Titia K. Sixma 0 0 Division of Molecular Carcinogenesis, Netherlands Cancer Institute , Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands The bipartite DNA-binding domain of Tc3 transposase, Tc3A, was crystallized in complex with its transposon recognition sequence. In the structure the two DNA-binding domains form structurally related helixturn-helix (HTH) motifs. They both bind to the major groove on a single DNA oligomer, separated by a linker that interacts closely with the minor groove. The structure resembles that of the transcription factor Pax6 DNA-binding domain, but the relative orientation of the HTH-domain is different. The DNA conformation is distorted, characterized by local narrowing of the minor groove and bends at both ends. The proteinDNA recognition takes place through base and backbone contacts, as well as shape-recognition of the distortions in the DNA. Charged interactions are primarily found in the N-terminal domain and the linker indicating that these may form the initial contact area. Two independent dimer interfaces could be relevant for bringing together transposon ends and for binding to a direct repeat site in the transposon end. In contrast to the Tn5 synaptic complex, the two Tc3A DNAbinding domains bind to a single Tc3 transposon end. - Tc1/mariner and other transposon families are widespread in animals (14). Within the invertebrates, the Tc1/mariners are most prevalent, both in genomic copy number and number of different transposons within the same organism (5). The Caenorhabditis elegans genome contains six types of active transposons, of which Tc3 is one (6). The Tc1/mariner transposons encode a single protein, the transposase, and are flanked at either end by inverted terminal repeats (ITRs). These ITRs contain one or two binding sites for the transposase (2). The transposase is capable of performing the entire transposition reaction in vitro (7,8). It has a bipartite DNA-binding domain, which binds to either end of the transposon through basespecific recognition of the ITRs by its N-terminal region (9). This positions the catalytic domain of the transposase, such that cleavage of the transposon can occur at specific TA sites at the end of each ITR (see Figure 1). Biochemical evidence suggests that dimerization of transposase molecules is needed to completely cleave the ITR ends (10). Dimerization is also necessary to bring the two ends of the transposon DNA together. In a semi-random fashion, this DNAprotein dimer then inserts into a TA site (6,11,12). The insertion process shows weak specificity for certain TA sites dependent on nucleotides immediately 4 bp upstream of this target site (6). The Tc1/mariner family encodes closely related transposases. These proteins are composed of three domains, the first two making up a bipartite DNA-binding domain, and the third a catalytic core domain containing a DDE motif found in many Mg2+-dependent catalytic enzymes (see Figure 1) (13,14). The bipartite DNA-binding domain studied in this paper is thought to be responsible for both the specific recognition of the ITRs and the stabilization of the catalytic domain against the DNA substrate. Bipartite DNA-binding domains occur across a large number of protein families, including the Tc1/mariner family and the structurally related Pax and Prd families of transcription domains (15). A well-studied example is the POU-family DNA-binding domains (16). Although overall amino acid sequences vary greatly, even within families, the secondary structures are conserved both in shape and function. All bipartite DNA-binding regions of proteins are characterized by having two domains separated by a linear stretch of amino acids. In most bipartite DNA-binding structures, the N-terminal domain is responsible for the recognition of specific DNA sequences, such as the ITRs for Tc1/mariner and other transposons. Within the Tc1/mariner family, bipartite DNA-binding regions also function to stabilize the whole protein against the DNA (14) allowing the DDE catalytic site to come into contact with the specific cleavage site. We have solved the structure of the N-terminal DNA recognition domain of Tc3A in complex with the recognition region of the transposon ITR previously (17). This structure showed that DNA recognition occurs through a combination of basespecific contacts and DNA-shape recognition. A putative protein dimerization was seen between the N-terminal domains, which could be important for bringing the two ends of the transposon together. Here, we extended our study of the Tc3 transposase DNA recognition to the full bipartite DNA-binding domain Tc3 transposase protein: MPRGSALSDT ERAQLDVMKL LNVSLHEMSR KISRSRHCIR VYLKDPVSYG TSKRAPRRKA LSVRDERNVI RAASNSCKTA RDIRNELQLS ASKRTILNVI KRSGVIVRQK LRPAPLLSAD HKLKRLEFAK NNMGT Tc3 transposon DNA: 54 29 G 5TA CA GTGTGGGAAAGTTCTATAGGACCCCCCCTAATTT 3 3AT GT CACACCCTTTCAAGATATCCTGGGGGGGATTAAA 5 28 3 cleavage site Tc3A binding region complexed to a longer fragment of the ITR. By using this X-ray structure, we get insight into the arrangement of this domain on DNA and the relative orientation of the two domains. Comparison with other bipartite structures shows similarities in structure, but differences in recognition and complex formation with DNA. MATERIALS AND METHODS Plasmid pRP-1442 (made by George Verlaan), containing the Tc3(1135) bipartite domain and a C-terminal 6 His-tag, was transfected into Escherichia coli BL21 DE3 cells and plated on carbenicillin plates. Single colonies were selected and grown in LuriaBertani (LB) media overnight. An aliquot of 40 ml of overnight culture was used to inoculate one liter of LB media, and cultures were grown to an OD600 of 0.6 in 4 h, at 37 C. Cultures were induced with 0.8 mM isopropyl-b-D-thiogalactopyranoside and grown for an additional 2 h. The cells were harvested and the protein was shown to be expressed solely in inclusion bodies. Cells were lysed by flash freezing and solubilized in B-PER protein extraction buffer containing 0.25 mg/ml of lysozyme, 0.25 mg/ml DNase T and 0.25 mg/ml RNase. Inclusion bodies were purified by three subsequent washes in detergent buffer containing 20 mM HEPES, 100 mM NaCl, 5 mM MgCl2, 0.5% Triton X-100 and 0.5% NP-40, pH 7.6, followed by three washes in 3 M urea. Inclusion bodies were solubilized in 6 M urea, 100 mM NaCl, 10 mM 2-mercaptoethanol and 10 mM Tris, pH 8.0. Purification of Tc3A(1135) was done by Talon Bead affinity chromatography, using a 40 mM imidazol wash with solubilization buffer, followed by elution with the same buffer containing 200 mM imidazol. Eluate containing the bipartite domain was then dialyzed against 20 mM sodium acetate, pH 5.5, 150 mM NaCl, 5% glycerol and 2 mM DTT with three subsequent buffer exchanges of 1:1000 for 4 h, 6 h and overnight. Dialyzed sample was centrifuged at 12 000 r.p.m. and the supernatant was loaded onto a Mono-S (Pharmacia) column and (...truncated)