Site-specific isotope labeling of long RNA for structural and mechanistic studies

Ikumi Kawahara 1 2 Kaichiro Haruta 2 Yuta Ashihara 2 Daichi Yamanaka 2 Mituhiro Kuriyama 2 Naoko Toki 2 Yoshinori Kondo 2 Kenta Teruya 0 Junya Ishikawa 4 Hiroyuki Furuta 4 Yoshiya Ikawa 4 Chojiro Kojima 1 3 Yoshiyuki Tanaka 2 0 Graduate School of Medical Science, Kyoto Prefectural University of Medicine , Kyoto 603-8334 1 Graduate School of Biological Sciences , NAIST, Ikoma 630-0192 2 Graduate School of Pharmaceutical Sciences, Tohoku University , Sendai 980-8578 3 Institute for Protein Research, Osaka University , Suita 565-0871, Japan 4 Department of Chemistry and Biochemistry, Graduate School of Engineering, Kyushu University , Fukuoka 819-0395 A site-specific isotope labeling technique of long RNA molecules was established. This technique is comprised of two simple enzymatic reactions, namely a guanosine transfer reaction of group I self-splicing introns and a ligation with T4 DNA ligase. The trans-acting group I self-splicing intron with its external cofactor, 'isotopically labeled guanosine 50-monophosphate' (50-GMP), steadily gave a 50-residue-labeled RNA fragment. This key reaction, in combination with a ligation of 50-remainder non-labeled sequence, allowed us to prepare a site-specifically labeled RNA molecule in a high yield, and its production was confirmed with 15N NMR spectroscopy. Such a site-specifically labeled RNA molecule can be used to detect a molecular interaction and to probe chemical features of catalytically/structurally important residues with NMR spectroscopy and possibly Raman spectroscopy and mass spectrometry. - In mechanistic studies of functional RNA, the signals from the functional residues (pinpointed studies) are important for characterizing their chemical nature and for elucidating the mechanism of action of the RNA (1). For this purpose, isotope labeling of functionally/structurally important residues enables us to extract pinpoint information from the functional RNA, by using NMR/ Raman spectroscopy and mass spectrometry. Currently, site-specific isotope labeling of RNA molecules has only been achieved with chemical syntheses (211), since an alternative enzymatic RNA synthesis is not compatible with site-specific modifications. However, the chemical synthesis is applicable only to short RNA/DNA oligomers (typically <20 nt) (217), due to low yields of long RNA/DNA chains. Therefore, to directly access spectral data from important residues in long functional RNAs and to skip the time-consuming assignment step, we established a site-specific isotope labeling technique of RNA molecules without any limitation of the RNA length (Figures 1 and 2). In NMR spectroscopy of RNAs, the isotope labeling technique [i.e. uniform (18,19) and nucleotide-specific (2023) ones] expanded the applicable molecular size limit. Recently, the segmental isotope labeling technique of RNA (2426) further enlarged this size limit. Although these techniques were oriented to 3D structure determination, a site-specific labeling technique of DNA/RNA oligomers is oriented to their chemical characterizations, such as the identification of the hydrogen bonding (2,5,1215,27,28) and metalation site (3,4,68,11,16,17) in a pinpoint manner. Specifically, direct evidence of the 15N15N J-coupling across the hydrogen bond (h22JNN) (12) and the HgII-mediated 15N15N J-coupling ( JNN) in T-HgII-T base pairs (8,16,17), were obtained by using appropriate site-specifically labeled DNA/RNA oligomers (for 2JNN, 15NHgII15N and 15NHgII14N, respectively). More importantly, the derived fine spectral data were utilized to evaluate the strength of the hydrogen bond (5,1315,27,28) and N-metal bond (8,17). Therefore, in order to apply such fine NMR spectra to any functional RNA molecule, site-specific labeling techniques without any applicable size-limit are becoming indispensable day by day. MATERIALS AND METHODS Synthesis of RNA oligomers for site-specific labeling of the hammerhead ribozyme The sequences of the used RNA/DNA oligomers are highlighted with yellow background in Figure 2d. RNA oligomers (50-fragment, 30-fragment precursor and substrate strand for the hammerhead ribozyme) were synthesized by a DNA/RNA synthesizer (ABI model 392, CA, USA). The C17 residue at the cleavage site of the hammerhead ribozyme substrate (inhibitor) was substituted with 20-O-methylcytidine to prevent the cleavage reaction with the hammerhead ribozyme (Figures 2a and 3a). The DNA bridge for the ligation reaction was purchased from TSUKUBA OLIGO SERVICE Co., Ltd. (Tsukuba, Japan). RNA oligomers were purified on an anionexchange column (mono-Q; GE Healthcare UK, Ltd., Buckinghamshire, England) with a linear NaCl gradient (02 M) under denaturing conditions (8 M urea). Excess NaCl and urea were washed out using an ultrafiltration device (Amicon Ultra-15 3000 MWCO; Millipore, MA, USA). Preparation of non-labeled hammerhead ribozyme The non-labeled hammerhead ribozyme was prepared by in vitro transcription. The template gene of the full-length hammerhead ribozyme was constructed in a pCR 2.1-TOPO vector (TOPO TA Cloning kit; Invitrogen, CA, USA), using synthetic DNA oligomers containing the T7 promoter and the coding sequence. Using this plasmid, PCR amplification was performed with the following primers. Forward primer: 50-GCGTA ATACGACTCACTATAGGATGTACTACCAGCTGA TGAG-30 and reverse primer: 50-mGmGCGTTTCGTCC TATTTGGGACTC-30. To prevent an overrun of T7 RNA polymerase, two 20-O-methylguanosine (mG) residues were added to the 50 end of the reverse primer (29,30). The RNA oligomer was directly transcribed from the PCR product using MEGA shortscriptTM kit (Applied Biosystems, CA, USA). The transcript was purified on an anion-exchange column (mono-Q), with a linear NaCl gradient (02 M) in denaturing conditions (8 M urea), and desalted by a gel filtration column (TSK-GEL G3000PW; TOSOH, Tokyo, Japan). Preparation of Tetrahymena group I intron and the general procedure for the optimization of the guanosine transfer Trans-acting Tetrahymena group I intron (3151) (the processing enzyme for the guanosine transfer reaction) was transcribed in vitro, using T7 RNA polymerase. For PCR amplification of the template DNA for in vitro transcription, we used a plasmid (pTZIVSU) (42,47) containing wild-type Tetrahymena group I intron (Figure 2b and Supplementary Figure S1), together with the following primers. By using the following primers, we obtained the trans-acting Tetrahymena group I intron (Figure 2c). Forward primer: 50-GAAGAGGCGTAATACGACTCACTATAGGGAT CGGAGATCTCAAAAGTTATCAGGCATGCACC TGGTAGC-30 50-GTACTCCAAAACTAATCAATATACTTTCGCAT ACAAATTAG-30 The Tetrahymena group I intron was transcribed from the PCR product using the script MAXTM Thermo T7 Transcription kit (TOYOBO, Osaka, Japan). To remove RNA polymerase, rNTPs and pyrophosphate, the transcript was cleaned by phenolchloroform extraction and dialysis using an ultrafiltration device (Amicon Ultra-15 3000 MWCO) or a cellulose dialysis tube (Spectra/Por Dialys (...truncated)