The nucleotide sequence of 5S rRNA from a red alga, Porphyra yeioensis

Volume 10 Number i g 1982 Nucleic Acids Research The nucleotide sequence of 5S rRNA from aredalga, Porphyra yeioensis Fumio Takaiwa, Mie Kusuda, Naotsune Saga and Masahiro Sugjura National Institute of Genetics, Mishima, Shizuoka-ken 411, and Institute of Algologjcal Research, Hokkaido University, Muroran, Hokkaido 051, Japan Received 24 August 1982; Accepted 2 September 1982 INTRODUCTION The nucleotide sequences of 5S rRNA have been determined from a wide variety of organisms (1) and used to construct a phylogenic tree (2, 3 ) . However, there have been no reports on the 5S rRNA sequences from red algae (Rhodophyta). In this paper, we present the nucleotide sequence of 5S rRNA from a marine red alga, Porphyra yezoensis which is a common species of edible sea-weeds in the Far East. This nucleotide sequence is compared with those of other 5S rRNAs. MATERIALS AND METHODS Foliose gametophytes of Porphyra yezoensis were collected at Denshinhama beach in Hokkaido island, Japan, in May 1981. The gametophytes were dehydrated by treating successively with ethanol, ethanol : ether (3 : 1, v/v), ethanol : ether (1 : 1, v/v) and ether. The dehydrated material was homogenized in an ice-chilled blender for 10 rain in the presence of 50 mM TrisHC1 buffer (pH 8.0) containing 5 mM EDTA and 2% SDS (w/v), and an equal volume of chloroform-phenol ( 1 : 1 , v / v ) . The total RNA was extracted three times with chloroform-phenol (1 : 1, v/v) and precipitated with ethanol. After fractionation by 12% polyacrylamide gel electrophoresis (4), 5S rRNA was further purified by a chromatography on lysine-sepharose 4B (Pharmacia) © I R L Press Limited, Oxford, England. 0305-1048/82/1019^0378 2.00/0 6037 ABSTRACT The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be : pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGUAAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euqlena qracilis (63% homology). Nucleic Acids Research as described (5). RNA sequencing was carried out as described (6). T4 polynucleotide kinase and RNA ligase were prepared as described (7, 8 ) . [ys2P]ATP and [5 l)2 P]pCp were obtained from the Radiochemical Centre. The nucleotide sequence of P_. yezoensis 5S rRNA is compared with those of other 5S rRNAs (Table 1 ) . The red algal 5S rRNA shows the highest homology (63%) with that of Euglena (9) among 5S rRNAs so far sequenced. This 5S rRNA, however, shows less Table 1 Sequence homology between £. yezoensis 5S rRNA and other 5S rRNAs Plants % Euglena Chlorella Chlamydomonas 63 62 51 Duckweed 54 Spinach 54 6038 Animals & Fungi Human KB cell 54 55 55 Yeast Neurospora Cellular slime mold 54 56 53 Drosophila Xenopus Bacteria & Organella % % B. subtilis A. nidulans 54 50 41 Tobacco chloroplast 35 Wheat mitochondria 41 E. coli RESULTS AND DISCUSSION When the total RNA from P. yezoensis was electrophoresed in a 12% polyacrylamide gel, one major band corresponding to 5S RNA was detected. This RNA species was then purified and seguenced. The sequence from the 3' end to position 3 could be determined by the direct chemical method using [3 |S2 P]5S rRNA. The sequence from the 5' end to position 45 could be read off by partial digestion with base-specific RNases using [5 |S2 P]5S rRNA, although C and U residues could not always be discriminated. The 5 1 and 3" terminal residues were further confirmed to be A and C, respectively, by PEI thin-layer chromatography after complete digestion of [5 lS2 P]5S rRNA with nuclease Pi and of [3 lS2 P]5S rRNA with RNase T 2 . The complete nucleotide sequence of P_. yezoensis 5S rRNA is shown in ABSTRACT. This 5S rRNA is composed of 121 nucleotides. Nucleic Acids Research homology with chloroplast and mitochondrial 5S rRNAs, indicating that it originates from the algal cytoplasm. 1 0 C A U A u 5'pACGUACGGC OHCUGCAUGUCG 3 UAS A G '- S A-U'° C-G C-G C-G A" 6 r " A 4 ^CI^GAC M CGC CUG \ \A C A C C JOCGGAA nOCCUU ACU G C C A U r C U A G-C A-U CG G A-U C-G U-A A A GA N Fig. 1. Secondary structural model of P. yezoensis 5S rRNA. 6039 A secondary structure model of P_. yezoensis 5S rRNA can be constructed according to the model proposed by Hori et al. (10). This model shows that the red algal 5S rRNA is classified into the eukaryotic type (Fig. 1 ) . However, there are some differences between P. yezoensis and a typical eukaryotic model. In the right arm in positions 30 to 50, P. yezoensis 5S rRNA has a 5 base-pairs helix in contrast to 4 base-pairs for all other cytoplasmic 5S rRNAs. The single-stranded loop connecting this helix is 11 nucleotides long and contains a GAAU sequence at positions 43-46 in contrast to either GAAC (bacteria and plants) or GAUC (fungi and animals). There is a looped-out residue (A) at position 18 in the helical region between positions 16-21 and 60-64. Loop-out residues can not be found at this region for all other 5S rRNAs. Therefore, P_. yezoensis 5S rRNA is unique in its secondary structure, suggesting that the red alga is phylogenically divergent from other organisms and is evolutionally ancient. Nucleic Acids Research ACKNOWLEDGEMENTS We thank Prof. S. Tanifuji (Hokkaido Univ.) for encouragement. This work was supported in part by Grants-In-Aid from the Ministry of Education, Science and Culture. To whom correspondence should be addressed. 6040 REFERENCES 1. Erdmann, V.A. (1982) Nucleic Acids Res. 10, r93-rll5. 2. Kimura, M. and Ohta, T. (1973) Nature New Biol. 243, 199200. 3. Hori, H. and Osawa, S. (1979) Proc. Natl. Acad. Sci. USA 76, 381-385. 4. Takaiwa, P. and Sugiura, M. (1980) Gene 10, 95-103. 5. Takaiwa, F. and Sugiura, M. (1982) Nucleic Acids Res. submitted. 6. Takaiwa, F. and Sugiura, M. (1981) Mol. Gen. Genet. 182, 385-389. 7. Sugiura, M. and Takanami, M. (1967) Proc. Natl. Acad. Sci. USA 58, 1595-1602. 8. Sugiura, M., Suzuki, M., Ohtsuka, E., Nishikawa, S., Uemura, H. and Ikehara, M. (1979) FEBS Lett. 97, 73-76. 9. Delihas, N., Andersen, J., Andresini, W., Kaufman, L. and Lyman, H. (1981) Nucleic Acids Res. 9, 6627-6633. 10. Hori, H., Osawa, S. and Iwabuchi, M. (1980) Nucleic Acids Res. 8, 5535-5539.  (...truncated)