A competitive regulatory mechanism discriminates between juxtaposed splice sites and pri-miRNA structures

Chiara Mattioli 0 Giulia Pianigiani 0 Franco Pagani 0 0 Human Molecular Genetics, International Centre for Genetic Engineering and Biotechnology , Padriciano 99, 34149, Trieste, Italy We have explored the functional relationships between spliceosome and Microprocessor complex activities in a novel class of microRNAs (miRNAs), named Splice site Overlapping (SO) miRNAs, whose pri-miRNA hairpins overlap splice sites. We focused on the evolutionarily conserved SO miR-34b, and we identified two indispensable elements for recognition of its 30 splice site: a branch point located in the hairpin and a downstream purine-rich exonic splicing enhancer. In minigene systems, splicing inhibition owing to exonic splicing enhancer deletion or AG 30ss mutation increases miR-34b levels. Moreover, small interfering-mediated silencing of Drosha and/ or DGCR8 improves splicing efficiency and abolishes miR-34b production. Thus, the processing of this 30 SO miRNA is regulated in an antagonistic manner by the Microprocessor and the spliceosome owing to competition between these two machineries for the nascent transcript. We propose that this novel mechanism is commonly used to regulate the relative amount of SO miRNA and messenger RNA produced from primary transcripts. - MicroRNAs (miRNAs) are 2123-nt long non-coding RNAs that regulate gene expression by affecting translation and/or stability of messenger RNA (mRNAs) (1). Embedded in coding or non-coding genes, the hairpin secondary structure of primary (pri)-miRNAs is initially cropped in the nucleus by Drosha, an RNase III-like enzyme that is part of the Microprocessor Complex (MPC), along with its cofactor DGCR8 (2). The resulting precursor (pre)-miRNA is 70 nt long and is exported to the cytoplasm where it is cleaved by Dicer to obtain the final mature form. On the nascent transcript, the MPCdependent processing of the pri-miRNA hairpin is an important and early regulatory event involved in miRNA biogenesis. Indeed, several proteins interfere with the activity of the MPC, including RNA-binding proteins that either affect components of the MPC (3,4) or directly interact with the pri-miRNA hairpins (58). The splicing reaction allows the maturation of a precursor (pre)-mRNA through the joining of the exonic sequences and the excision of the introns; to correctly identify exons, the splicing machinery recognizes the core cis-acting elements (9,10) that consist of the 50 and 30 splice sites (ss) and include the polypyrimidine tract and the branch point (BP) near the 30ss. Recognition of the exon requires also splicing regulatory elements that are classified, depending on their location and effect on splicing, as exonic/intronic splicing enhancer and exonic/ intronic splicing silencers (9,10). These elements are crucial for alternative splicing regulation, a mechanism present in the majority of human genes that enormously increase the transcript diversity through the selection of alternative splice sites (9). The exonic elements are composed of largely degenerated poorly conserved sequences and interact with splicing factors that may have a positive (serine/arginine-rich (SR) proteins) or a negative heterogeneous nuclear ribonucleoproteins (hnRNPs) effect on exon recognition (11). Several polymerase II (PolII) precursor transcripts are processed co-transcriptionally by the spliceosome and the MPC into spliced mRNAs and miRNAs, respectively. In the case of intronic miRNA hairpins, which represent almost half of miRNAs (12), Drosha cleavage occurs before splicing and does not significantly affect the amount of mRNA (12,13). On the other hand, intronic pri-miRNA hairpins, both in coding or non-coding transcripts, are preferentially located at a distance from splice sites to avoid possible interference between the two processing machineries (12,13). Experiments using minigenes and in vivo analysis indicate that Drosha cleavage The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. at intronic pri-miRNAs can both increase (12,14) and decrease (13,15) the splicing efficiency. pri-miRNA processing is more efficient if hairpins are retained at the sites of transcription (16), and, in some constructs, splicing disruption of both the 50ss and 30ss was found to affect miRNA biosynthesis (13). However, for the intronic miR-211, only mutations at the 50ss were reported to reduce the biogenesis of the miRNA. miR-34b, along with the related miR-34a and miR-34c, is involved in several physiological and pathological conditions. Originally identified as a tumour suppressor miRNA (1719), miR-34b is involved in osteoblast proliferation (20,21), pathological cardiac remodelling (22) and Huntington and Parkinson diseases (23,24). miR-34b and miR-34c are part of the same non-coding transcriptional unit on chr11, possibly regulated by a p53-responsive promoter (25). The transcriptional unit is composed of two exons separated by a 2 kb long intron. miR-34c is part of the last exon, whereas miR-34b is unexpectedly located on the boundary between intron 1 and exon 2. In this study, we have identified a peculiar class of miRNAs, including miR-34b, whose hairpins overlap with splice sites and whose biogenesis is regulated by splicing. We have named these Splice site Overlapping (SO)-miRNAs. SO miR-34b overlaps with a non-canonical 30ss, whose recognition depends on a strong BP and a purine-rich exonic splicing enhancer (ESE). Splicing inhibition by mutation of the 30ss or the ESE, but not the 50ss, increases miR-34b biosynthesis, whereas reduction of the Drosha/DGCR8 levels by RNAi knock-down increases splicing efficiency. MATERIALS AND METHODS HeLa cell culture and transfection, RNA extraction, reverse transcription (RT)-PCR and quantification of the percentage of splicing were performed as previously described (26). For the analysis of spliced isoforms, pBRA 34b minigenes were amplified with BRC90BsteII for (ctggtgaccaagtttgccagaaaacaccacatcactttaactaatc) and glo800 rev (gctcacagaagccaggaacttgtccagg); pcDNA3pY7 miR-34b constructs were amplified with pY7 ex2 dir (tacaaggcttgtcgaggaggacatc) and miR34b_2505XbaI rev (tatctagaccacgccgacgccgcgct). For co-transfection experiments, HeLa cells were transfected with 500 ng of the minigene construct together with 500 ng of an empty vector or vectors containing the proteins of interest. Detection of spliced and unspliced miR-34b transcripts in mouse and human tissues The human total RNA of 20 tissues was purchased from Amsbio, whereas the mouse one was extracted from tissues using TriReagent (Ambion) according to manufacturers instructions. The primers used for the RT-PCRs performed to detect the spliced and unspliced isoforms of human miR-34b transcripts were as follows: 34b_131 for (agtaggcaatgcatcttcatgac) and 34b_521 rev (ccttcgagagaagatgcctg) for the splicing form and 34b_233 for (cttttcaaggcatctgaccc) and 34b_435 rev (aatagtcttcattccattaaca) for the (...truncated)