dutA RNA functions as an untranslatable RNA in the development of Dictyostelium discoideum

Nucleic Acids Research, 1994, Vol. 22, No. 1 41-46 dutA RNA functions as an untranslatable RNA in the development of Dictyostelium discoideum Hiderou Yoshida, Hiroshi Kumimoto and Koji Okamoto Department of Botany, Faculty of Science, Kyoto University, Kyoto 606-01, Japan Received October 7, 1993; Revised and Accepted December 6, 1993 DDBJ accession no. D16417 ABSTRACT MATERIALS AND METHODS dutA General methods is a gene specifically expressed during the INTRODUCTION There is a class of RNA (structural RNA) which exhibits its function by itself without being translated into protein, for example, rRNA, tRNA or RNAs in ribozymes (1, 2) and spliceosomes (3, 4). Recently, several new structural RNAs have been reported. Mouse H19 RNA (5, 6) is induced during embryogenesis and has tumor-suppressor activity. Human X1ST RNA (7) is thought to be responsible for the inactivation of the X chromosome. However, their action mechanisms are still unclarified. We previously identified a gene (previously called DC6) in Dictyostelium discoideum, whose expression is strictly regulated in development through the interaction between cells, and thus may be implicated in the developmental process (8). In the present study, we cloned the gene, characterized its complete cDNA, examined the subcellular localization of its RNA and disrupted the gene. The peculiar sequence (such as no sustained ORF, long palindromes) and the unexpected localization of its RNA (the complete absence from ribosomes) suggest that this RNA is not an mRNA but a structural RNA. We thus refer this gene to dutA (development-specific but untranslatable RNA). Our preliminary results suggest that cognate sequences are widespread among organisms. The strain Ax2 of D. discoideum was used and all manipulations of cells were performed according to Sussman (9). We usually used the cells (T(15) cells), which developed for 15hr in suspension (20 mM Na2HPO4/KH2PO4 pH7.0, 2 mM MgSO4). Transformation of Ax2 cells was carried out by the calcium phosphate method (10). DNA and RNA manipulations were performed as described by Maniatis et al. (11). DNA labeling and cDNA library construction were done with a multiprime DNA labeling system (Amersham) and a You-Prime cDNA synthesis kit (Pharmacia LKB), respectively. Filter hybridization with DNA probes was carried out for 12 hr at 42 °C in the presence of 50% formamide and 5XSSPE, and washed at 37°C or 50°C in 0.1 XSSC and 0.1% SDS. PCR was performed with a thermal cycler B-641 (KURABO) according to the manufacture's instruction. For RT-PCR, poly(A) RNA was reverse-transcribed and resultant cDNA was amplified with Tth polymerase (TOYOBO) according to Myers and Gelfand (12). Isolation of genomk clones Genomic clone EE2900 was isolated from genomic mini-library. Nuclear DNA of Ax2 cells was digested with EcoRI and separated in 0.8% TAE-agarose gel. 2.3-4.3 kb fragments of digested DNA were collected and inserted into plasmid pUCl 18. This library was screened with labeled C6A probe (a previously isolated cDNA clone). ME900 were isolated by inverse PCR (13). Nuclear DNA which was digested with Mbol and ligated to be circularized was used as a template, and amplification was carried out with primer H and I (Fig. 3). Fractionation of cellular components Developed Ax2 cells (in the slug stage) were mildly lysed in the lysis buffer (50 mM Hepes (pH 7.5), 1% Triton X-100, 10% sucrose and 5 mM MgSO4). The lysate was fractionated by differential centrifugation, i.e., at 400 g for 5 min and then at 2,000 g for 5 min. First precipitate (PI: cell debris) and second precipitate (P2: nuclear fraction) wereresuspendedin lysis buffer. Second supernatant (S2: cytosol-organelle fraction) was further fractionated by 15—40% sucrose density gradient centrifugation at 100,000 g for 3 hr. development of Dictyostelium discoideum. Toward understanding Its possible role In development, we Isolated and characterized the gene and Its complete cDNA. We found that dutA is encoded by the nuclear genome as a single copy gene without Introns. In addition, the following unique and Interesting features oldutA RNA (1322 nt) emerged: (1) It has no sustained ORFs (MAX = 126 nt) (2) it Is extremely AU-rich (83%) (3) it contains peculiar sequence motifs (large palindromes, long AU-stretches and GC-clusters) (4) It is localized In the cytoplasm but completely absent from ribosomes. These features suggest that dutA RNA functions without being translated into protein. Disruption of the dutA gene did not cause phenotyplc changes, suggesting that the function of dutA is redundant. 42 Nucleic Acids Research, 1994, Vol. 22, No. 1 X T H E T T B T EE2900- ME900- aaatttattaatttsatttattattttttctttttttttttttttttttttttttttttt -168 tiatsaaaagatacacctcaaaaacatttcagttgactgtattaactttgttgtgatatt -108 attttcatatttttttatcataaatgaaattattaagaaactcactgattgaacgtttct [TATAn TT T -48 13 agattttassataatataaaaaaatgaattcaaataattagttcttaTTTTGAAAATGAA 73 AAAAAAGTGGAATTTAATTAATTAAAI11111111IAI1111111IAI1111111111IG -0EL15OOL "[ = Fragmei -EX889 -XE2000 ED211 GAAATMfTGGCTATG(aCCAAATG6AAAATAAAAAAGGAAAAAAAnAAAATAAGAATT 193 AAATTTATAATAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAATAAAAnAAAAAATAA C E Pr iraers -C6A -C6B cOHA c l o n e s — S I napping 313 nGGGGTAAAAAAAAAAAAAAAATAAAAAAAAAATAAnAAAAATTAAAAACACACATTA 373 BTTG(^TTTaGAT/WTAATAAAATTrTTTTTAan/WTMCT(rrTACAGATAATTTA 433 TTTAATTTTGAAnAAATnATTTTTTTAATAATTTTTTOkAAAACTATTTAAGAGACAA 493 AATTTTTTTATrnGTrATTCAAAAATGTCAAATAAATAAAAAAAAAAAAAAAAAAATAA 553 AAAAAAATnAATM(rrTTTAAAATGGTATA(nTTTAATAAAAAAAAAAAAAAAACCACT 613 ATCAHAGTACT/WAAAAAAAATAAAAAATAAAAAAAAAAAAAATAAAAAAAAATAATAA 673 TAAGCTATAIXATGGGACTTAGAGAAAATAAAAAAGTTTAAAAAAAAAATAAAAAATAAT T33 AAAAAATAAAAAAAAAATAAAAAAAAAAACTTnAAAACTCTCCTTCTACTTTTTGOTGC I priaar J => nCTGnAAaTAATGaAAGGTGTaCTaCCCCCTTTGCTTTGCAnACTCTCCTCAA 793 priwr K —=>i priwr F — o ^TMT(rra5AGCTCaACGATGCT(r primer D p <=— ppnaer E CCTATGCAA CAaTTCCTATGCAAaaCTCAAATGTATAAGCACTCnTAACAAAAAAAAATATTTAA AA^^AAAAAAAAAAGAAAAAAAAAAAATATTAAAATATTTTTTTTAAAATCAATTTTAAA TATAAATAATAATUI11111111IIIIATAAAAAAAAGAAAGAAAAAAAGAAAAAAAAAA AAAAAAGAAAAAAAGAATTTAAAAAAAAAAAAAAAAATAGAAAAAAAAAAGTTAAAGATG TGCA + - r VEfr| + - M -3 i •• Figure 2. SI nuclease protection assay. Poly(A) RNA of t l 3 cells (DEV) or vegetative cells (VEG) was hybridized with the labeled ncmcoding strand of ED211, digested with 30 units of SI nuclease (+) or undigested ( - ) (reaction volume = 200 /J), and separated on a 6% acrylamide-urea gel. Protected fragments are indicated by dots. A sequencing ladder of ED211 was run in parallel. Construction of the disruption vector and the antisense vector The disruption vector was made as follows: EE2900 was inserted into pUC119 at the EcoRI site and a plasmid in which the upstream region in EE2900 was located near the BamHI site was selected (PUC-EE2900S). EE800 fragment was blunted with Klenow fragment and inserted into pUC119 at the HincII site and a plasmid i (...truncated)