Information propagation through enzyme-free catalytic templating of DNA dimerization with weak product inhibition

nature chemistry Article https://doi.org/10.1038/s41557-025-01831-x Information propagation through enzyme-free catalytic templating of DNA dimerization with weak product inhibition Received: 23 August 2023 Accepted: 14 April 2025 Published online: xx xx xxxx Check for updates Javier Cabello-Garcia 1,2, Rakesh Mukherjee Guy-Bart V. Stan1,2 & Thomas E. Ouldridge 1,2 , Wooli Bae 1,2 , 1,2,3 Information propagation by sequence-specific, template-catalysed molecular assembly is a key process facilitating life’s biochemical complexity, yielding thousands of sequence-defined proteins from only 20 distinct building blocks. However, exploitation of catalytic templating is rare in non-biological contexts, particularly in enzyme-free environments, where even the template-catalysed formation of dimers is challenging. Typically, product inhibition—the tendency of products to bind to templates more strongly than individual monomers—prevents catalytic turnover. Here we present a rationally designed enzyme-free system in which a DNA template catalyses, with weak product inhibition, the production of sequence-specific DNA dimers. We demonstrate selective templating of nine different dimers with high specificity and catalytic turnover, then we show that the products can participate in downstream reactions, and finally that the dimerization can be coupled to covalent bond formation. Most importantly, our mechanism demonstrates a design principle for constructing synthetic molecular templating systems, a first step towards applying this powerful motif in non-biological contexts to construct many complex molecules and materials from a small number of building blocks. Cells produce tens of thousands of distinct proteins from 20 amino acids1. Were these amino acids to polymerize in isolation and then fold, it would result in the formation of a heterogeneous population of products; the amino acid monomers do not encode enough information in their interactions alone to direct the assembly of so many specific proteins from the astronomically large catalogue of possible products2. Instead, biology assembles complex macromolecules from simple monomers with high precision templating processes—RNA transcription and protein translation—wherein sequence information is efficiently copied from a copolymer template into a newly produced daughter copolymer3. Mechanistically, this copying involves sequence-specific recognition interactions between template and daughter. Equally, however, these interactions must eventually be disrupted so that the daughter dissociates, allowing sequence-directed folding of the daughter4 and reuse of the template5–8. Although biological templating relies upon enzyme-catalysed reactions, there has been wide interest in rationally engineering enzyme-free templating mechanisms to assemble specific molecules9. Many researchers seek to use templating to enhance reactions that have an otherwise low yield10,11. Others pursue templating as a pathway to synthesize new, complex, sequence-controlled polymers12,13 or even use biological polymers, such as DNA, as an easily synthesized template for directing combinatorial screenings to discover new materials and molecules with therapeutic potential14,15. More ambitiously, biologically relevant polymers are used as templates to understand the origin of life or engineer synthetic life6,16–19. Department of Bioengineering, Imperial College London, London, UK. 2Imperial College Centre for Engineering Biology, Imperial College London, London, UK. 3School of Mathematics and Physics, University of Surrey, Guildford, UK. e-mail: 1 Nature Chemistry Article https://doi.org/10.1038/s41557-025-01831-x a C a′ Toehold binding I t′ Handhold (h) a C a′ a′ Branch migration C h′ t old eh To s g din Bra nc hm t2 Lock (L) a a' 1 t x′ MxTxy s hy t x′ a t2 t1x a′ s hy t2′ a t1x′ s hy′ Product (MxNy) a′ hy′ Monomer N (Ny) MxNy /Txy M1L N1 M2L N2 M 3L N3 t′ a′ T13 Clamp 5′ t2′ a′ a t11 CAAATCC Reaction 2: handhold-mediated strand displacement. t′ t Pool N Clamp 3′ CAAATC t2 t2 Pool M 2 ired epa rive es r d tch ction ma Mis ∆G rea ∆ Copied domains on TGC TTT G CTA AAC CTT TAA TGA AGA CCT TGA CTA AAC TAC TGG CCT GGA TGA AAT CCT TGG TTA AAC CGA TGG CAG GCTAA C CGT Primary toehold (t1x) 1 I Clamp 3′ a′ h′ I CACCATTC h3′ M1N3 t2′ AGTTTAGG CGTTTTATCTTCACTTCCATCCATTCCAGTTCCATTAGCG TT GTGGTAAG a′ t11 TTT Template (Txy) R t′ ATTTTGC TTGACTTCT TTACCTACC CCTTGACC CAGCGATTA Secondary toehold (t2′) h t a′ R Handhold detachment ati Clamp 5′ Reaction 1: toehold exchange (TMSD variant) t2 igr CGCA A GCGTTTAATAGAAG TATCTT TCAAGG CACTT TAGGTA AGG CCATC CATTCC TCAAGGTA AT ACTTC CATTAGCGCTGC TTT CGACG d = Sequence mismatch a s a a h Monomer M (MxL) a′ bin h′ c a′ t′ t b R C a′ TTT R t′ s I Toehold (t) Mism atche a a′ h3′ CACC ATTC t1′1 a′ s h3 Fig. 1 | DNA strand displacement topologies, catalysis mechanism of the template and system design. a, TMSD. Binding to the toehold (t) domain in the target DNA strand (R) mediates displacement of the incumbent (C) by the invader (I). After displacement, the toehold is cooperatively sequestered in duplex IR. b, HMSD. When I binds to the handhold (h) domain in C, the effective concentration of I increases in the vicinity of R, enhancing displacement. The reversible nature of handhold binding allows IR to detach. c, The DNA-based catalytic templating system. The DNA monomers (MxL and Ny) can dimerize after binding to a DNA template (Txy), exploiting first toehold exchange (a TMSD variant) then HMSD. Dimerization between the monomers weakens the interaction with Txy, allowing MxNy to detach and for Txy to undergo another dimerization cycle. d, The specific-sequence domains of Txy can trigger the dimerization of a specific MxL, Ny pair from pools of monomers in solution. The result is a product distribution enriched in MxNy dimers with t and h domains (red boxes) complementary to Txy, propagating the sequence information in the template. Any x,y combination is possible, with the dimerization domain a initially hidden by L, inhibiting any direct reaction in the absence of Txy. The edges of the MxL duplex have additional bases—‘clamps’—suppressing any leak reactions. The two mismatched base pairs in the a domain of MxL ensure that dimerization is thermodynamically favoured. The DNA strands are represented by domains (contiguous sequences of nucleotides considered to hybridize as a unit). The domains are labelled with a lowercase letter; a prime symbol indicates complementarity; for example, a′ binds to a. When designing enzyme-free templating systems, one of the biggest challenges, rather than efficient monomer recognition, is producing templates that act effectively as catalysts. To ensure a reliable copying system, the reaction of monomers must be slow in solution but occur rapidly and with high turnove (...truncated)