Pregnancy after preimplantation genetic diagnosis for Ataxia Telangiectasia

Ali Hellani 1 Anthony Lauge 1 Pinard Ozand 1 Kamal Jaroudi 1 Serdar Coskun 1 0 10 Riyadh, 11211 Saudi Arabia 1 King Faisal Specialist Hospital and Research Center, Department of Pathology and Laboratory Medicine, ART Section , P.O.Box 3354 MBC Ataxia Telangiectasia (AT) is an autosomal recessive disorder with an incidence estimated at 1 in 40 000 to 1 in 100 000 live births. More than 100 different somatic and germ-line mutations have been identified in the AT gene, the majority of which cause premature protein truncation. The immense size of the AT gene (66 exons) complicates the detection of mutations. A Saudi family with three affected children suffering from AT consulted our IVF centre for preimplantation genetic diagnosis (PGD). Despite advanced maternal age and unknown mutation, the family was screened for AT mutations. A large deletion in the gene was found to be responsible for the phenotype of AT. The mutation detection permitted us to perform PGD on AT for the first time. Single cell PCR consisted of amplifying one of the deleted exons, exon 19. Homozygous affected embryos show an absence of the exon, while in heterozygous or normal embryos the exon is amplified successfully. After ICSI, three embryos were suitable for embryo biopsy. After biopsy only one embryo showed exon amplification and was transferred. A singleton pregnancy ensued and prenatal diagnosis confirmed the presence of exon 19. This report demonstrates that PGD is feasible despite advanced maternal age and poor response to follicle stimulation. - The Ataxia Telangiectasia (AT) gene responsible for ataxia telangiectasia (Savitsky et al., 1995, 1997) is an autosomal recessive disorder characterized by cerebellar ataxis and progressive neuromotor degeneration, immune deficiency, and the appearance of dilated blood vessels in the eyes and face (telangiectasias). Patients also manifest growth retardation, premature ageing of skin and hair, chromosomal instability, lymphoreticular malignancies and acute sensitivity to ionizing radiation. The protein-coding region of the AT gene contains 9168 bp in 66 coding exons spread over 146 kb of genomic DNA (Platzer et al., 1997). The AT gene displays a complex mutational spectrum. Thus far, more than 100 different somatic and germ-line mutations have been identified, the majority of which cause premature protein truncation (Gilad et al., 1996). The large size and genomic structure of the AT gene greatly complicates the process of screening genomic DNA samples for all possible sequence variations. Preimplantation genetic diagnosis (PGD) is an alternative to prenatal diagnosis for couples who have a high risk of transmitting inherited disease to their offspring. PGD is performed on one or two single blastomeres biopsied from 4- to 10-cell embryos on day 3 after fertilization (Handyside et al., 1990). The possibility of selecting and transferring only unaffected embryos to the uterus is an alternative to elective abortion following prenatal diagnosis of an affected fetus. To our knowledge, this report describes for the first time PGD to detect AT. A Saudi family with three AT affected children was accepted in our PGD programme. Since the mutation causing the AT phenotype was unknown, we screened the family to determine the mutation involved. After mutation identification, we performed a single cycle of PGD and an ongoing pregnancy was obtained. Prenatal diagnosis has confirmed the PGD diagnosis. Patients and methods Three AT patients from the affected family were studied; Table I summarizes their clinical features. The carrier parents were first cousins. Peripheral blood was drawn from the family to extract DNA and isolate single lymphocytes for mutation identification and PGD test optimization. PCR procedure for mutation detection In order to assess the mutation causing the AT phenotype, genomic DNA was analysed at the following exons: 5, 6, 8, 10, 14, 16, 17, 19, 25, 27, 33, 63 and 64. The primers and PCR conditions used were as described previously (Vorechovsky, 1996). Briefly, AT exons were amplified from 100 ng of DNA using specific primers (10 mol/l), dNTP (2.5 mmol/l), MgCl2 (50 mmol/l), PCR buffer 10 and one unit of Taq (5 IU/ l) polymerase (Life Technology, USA). PCR products were analysed on 2% agarose gels containing ethidium bromide and visualized under UV light. PGD test optimization on lymphocytes A total of 10 single leukocytes from each of both parents and the affected children was collected in a 0.5 ml PCR tube containing 5 l of lysing buffer (1% Tween 20, 1% triton 100 , 1 PCR buffer and 20 mg/ml proteinase K) (Verlinsky and Kuliev, 2000). Aliquots from the last washing droplets were taken to serve as blanks (five tubes). Samples and blanks were incubated at 45C for 15 min, followed by proteinase inactivation at 96C for 20 min. Cell lysates were used directly for amplification or stored at 80C. Malignancy No No No No No Radio sensitivity Intermediate Intermediate 4 4 4 Age (years) 50 42 23 17 12 Sex Male Female Male Female Male Onset (years) 2 2 2 Gait ataxia Yes Yes Yes Limb ataxia Yes Yes Yes Dysarthia Yes Yes Yes Chorea and/or disotnia Yes Yes Yes Eye movements Yes Yes Yes Peripheral neuropathy No No No Infection Mild Mild Mild Embryo biopsy A hole was made in the zona pellucida by a stream of acidic Tyrodes (Medicult, Denmark) using a fine needle (Inzuza et al., 1998). One blastomere was gently aspirated through the hole in each embryo. After biopsy, the blastomeres were checked for the presence of a nucleus and transferred to a 0.5 ml PCR tube containing 5 l of the previously described lysing buffer. PCR tubes were incubated at 45C for 15 min and at 96C for 20 min. PCR procedure The reaction mixes for PCR were decontaminated by UV exposition for 45 min. Reaction mix was added to the cells to a final volume of 20 l and final concentration of 10% dimethylsulphoxide (DMSO), 50 mmol/l KCl, 100 mmol/l TrisHCl pH 8.3, 2 mmol/l MgCl2, 0.1 mg/ml gelatin, 0.2 mmol/l dNTP, 1 mol/l primers (forward: GTTGTGCCCTTCTCTTAGTGTT; reverse: ACTCATTACATTTAGTCAGCAA) and 1.25 IU Taq polymerase (Life Technology). PCR was carried out on a Biometra thermocycler using the following programme: 5 min denaturation at 96C followed by 28 cycles of 20 s at 96C, 60 s at 55C and 20 s at 72C, and completed by 6 min at 72C. An aliquot of 2 l from the first PCR was seeded into a second round PCR reaction. The reaction mix had the same final concentrations and volume as the first round PCR mix except that the inner primers (forward: CTTGAACATCTTTGTTTCTCTTCCTGAAG; reverse: GTAAATACATATTTACTACTTGGGATTTCT) were used. The PCR programme for the second round was 5 min denaturation at 96C followed by 30 cycles of 20 s at 96C, 60 s at 55C and 20 s at 72C, completed by 6 min at 72C. The PCR products were separated on a 2% agarose gel, run at 100 V for 1 h. Prenatal diagnosis procedure Prenatal diagnosis was performed on DNA extracted from chorionic v (...truncated)