Relevance of GSTM1, GSTT1, and GSTP1 gene polymorphisms to gastric cancer susceptibility and phenotype

M Asuncin Garca-Gonzlez 0 11 12 Enrique Quintero 0 10 Luis Bujanda 0 11 17 David Nicols 0 10 Rafael Benito 0 11 16 Mark Strunk 0 11 12 Santos Santolaria 0 15 Federico Sopea 0 11 14 Mara Bada 0 14 Elizabeth Hijona 0 17 M Angeles Prez-Asa 0 19 Isabel M Mndez-Snchez 0 19 Concha Thomson 0 18 Patricia Carrera 0 11 Elena Piazuelo 0 11 12 Pilar Jimnez 0 11 Jess Espinel 0 13 Rafael Campo 0 8 Marisa Manzano 0 9 Fernando Geijo 0 6 Maria Pellis 0 7 11 Ferrn Gonzlez-Huix 0 4 Jorge Espins 0 5 LLusia Tit 0 2 Manuel Zaballa 0 3 Roberto Pazo 0 1 Angel Lanas 0 11 12 14 0 Miguel Servet, Laboratorio de Investigacin Molecular , Edificio Consultas Externas 4 planta, C/Padre Arrupe s/n, 50009 Zaragoza, Spain . Tel: 1 Department of Oncology, Hospital Miguel Servet , Zaragoza, Spain 2 Department of Gastroenterology, Hospital de Matar , Spain 3 Department of Gastroenterology, Hospital de Cruces , Baracaldo, Spain 4 Department of Gastroenterology, Hospital Josep Trueta , Gerona, Spain 5 Department of Gastroenterology , Mutua de Tarrasa, Spain 6 Department of Gastroenterology, Hospital Clnico Universitario , Salamanca, Spain 7 Department of Gastroenterology, Hospital Clinic I Provincial , Barcelona, Spain 8 Department of Gastroenterology, Hospital Parc Tauli , Sabadell, Spain 9 Department of Gastroenterology, Hospital 12 de Octubre , Madrid, Spain 10 Department of Gastroenterology, Hospital Universitario de Canarias , Tenerife, Spain 11 CIBER de enfermedades hepticas y digestivas, Zaragoza, Spain 12 Instituto de Investigacin Sanitaria Aragn (IIS Aragn) , Zaragoza, Spain 13 Department of Gastroenterology, Complejo Hospitalario , Len, Spain 14 Department of Gastroenterology, Hospital Clnico Universitario Lozano Blesa , Zaragoza, Spain 15 Department of Gastroenterology, Hospital San Jorge , Huesca, Spain 16 Faculty of Medicine and Department of Microbiology, Hospital Clnico Universitario , Zaragoza, Spain 17 Department of Gastroenterology, Hospital Donostia, Faculty of Medicine, University of Basque Country , San Sebastin, Spain 18 Department of Gastroenterology, Hospital Obispo Polanco , Teruel, Spain 19 Department of Gastroenterology, Hospital del Sol , Marbella, Spain The Author 2012. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: . - Human glutathione S-transferases (GSTs) are phase II metabolizing enzymes that play a key role in protecting against cancer by detoxifying numerous potentially cytotoxic/genotoxic compounds. The genes encoding the human GST isoenzymes GSTM(mu)1, GSTT(theta)1 and GSTP(pi)1 harbour polymorphisms, which have been considered important modifiers of the individual risk for environmentally induced cancers such as gastric cancer (GC). However, results are inconsistent among studies from different geographic areas and ethnic groups. Our goal was to perform a nationwide, casecontrol study in Spain to evaluate the relevance of several functional GST gene polymorphisms and environmental factors to GC risk and phenotype. DNA from 557 GC patients and 557 sexand age-matched healthy controls (HC) was typed for two deletions in the GSTM1 and GSTT1 genes and two SNPs in the GSTP1 gene (rs1695 and rs1138272) using polymerase chain reaction-restriction fragment length polymorphism methods. Logistic regression analysis identified Helicobacter pylori infection with CagA strains [odds ratio (OR): 2.36; 95% confidence interval (CI): 1.783.15], smoking habit (OR: 2.10; 95% CI: 1.482.97) and family history of GC (OR: 3.2; 95% CI: 2.025.16) as independent risk factors for GC. No differences in the frequencies of GSTM1 or GSTT1 null genotypes were observed between cases and controls (GSTM1: 50.8% vs. 48%; GSTT1: 21.5% vs. 21%). Moreover, simultaneous carriage of both, the GSTM1 and the GSTT1 null genotypes, was almost identical in both groups (10.7% in GC vs. 10.6% in HC). In addition, no significant differences in GSTP1 Ile105Val (rs1695) and GSTP1 Val114Ala (rs1138272) genotype distribution were observed between GC patients and controls. Subgroup analysis for age, gender, Helicobacter pylori status, smoking habits, family history of GC, anatomic location and histological subtype revealed no significant association between GST variants and GC risk. Our results show that the GST polymorphisms evaluated in this study are not relevant when determining the individual susceptibility to GC or phenotype in a South-European population. Introduction Human glutathione S-transferases (GSTs) are phase II metabolizing enzymes that play a key role in protecting against cancer by detoxifying numerous potentially cytotoxic/ genotoxic compounds (1). The genes encoding the three major GST isoenzymes, GSTM(mu)1, GSTT(theta)1, and GSTP(pi)1, widely expressed along the human gastrointestinal tract (2), are highly polymorphic. Two common deletion polymorphisms in the GSTM1 and GSTT1 genes that result in lack of the corresponding active protein have been extensively studied. GSTM1 and GSTT1 are deleted in a high percentage of the human population, with major ethnic differences. Among Europeans, GSTM1 and GSTT1 deletion frequencies range from 40 to 60% and from 13 to 26%, respectively (3). Individuals homozygous for such gene deletions (hGSTM1*0/*0, hGSTT1*0/*0) exhibit a loss of GSTT1-1 and GSTM1-1 enzyme activity in all tissues. In addition, two single-nucleotide polymorphisms (SNPs) in the GSTP1 gene, resulting in amino acid substitutions at codons 105 (IleVal) (4) and 114 (ValAla) (5), have been associated with diminished GST enzyme activity for several classes of substrates. Because GSTs are involved in the detoxification of a wide variety of potentially toxic and carcinogenic substances, it is plausible that reduction of their enzyme activity could render an individual more susceptible to developing certain types of malignancies. In this context, GSTM1 and GSTT1 null genotypes have been implicated as risk factors for a wide array of cancers, including lung, colorectal and esophageal cancers (6,7). Moreover, the GSTP1 105Val variant has been linked to increased risk for bladder and testicular cancers (8). However, there is not conclusive data concerning the relationship between GST variants and gastric cancer (GC), a disease of particular interest resulting from complex interactions between the host and environmental factors. In an Italian study, Boccia et al. (9) found a significant association Albumin GSTP1 I105V (rs1695) GSTP1V114A (rs1138272) Primers (5' to 3') Sense: GAACTCCCTGAAAAGCTAAAGC Antisense: GTTGGGCTCAAATATACGGTGG Sense: TTCCTTACTGGTCCTCACATCTC Antisense: TCACCGGATCATGGCCAGCA Sense: GCCCTCTGCTAACAAGTCCTAC Antisense: GCCCTAAAAAGAAAATCGCCA ATC Sense: AATACCATCCTGCGTCACCT Antisense: TGAGGGCACAAGAAGCCCCTT Sense: ACAGGATTTGGTACTAGCCT Antisense: AGTGCCTTCACATAGTCATCCTTG Annealing temperature 60C 60C Type of polymorphism Gene deletion Gene deletion BsmAI RFLP Alleles Null genotype + Fragment of 2 (...truncated)