High amounts of genetic differentiation between populations of the malaria vector Anopheles arabiensis from West Africa and eastern outer islands.

0 FREDERIC SIMARD , DIDIER FONTENILLE, TOVI LEHMANN, ROMAIN GIROD, LAURENT BRUTUS, RAHEEM GOPAUL, CHRISTIAN DOURNON Polymorphism at nine microsatellite loci was examined to assess the level of genetic differentiation between four Anopheles arabiensis populations from Senegal, the high plateau of Madagascar, and Reunion and Mauritius islands. Eight of nine loci showed great polymorphism (2-16 alleles/locus) and significant genetic differentiation was revealed between all four populations by F- and R-statistics, with Fst estimates ranging from 0.080 to 0.215 and equivalent Rst values ranging between 0.022 and 0.300. These high amounts of genetic differentiation are discussed in relation to geographic distance including large bodies of water, and history of mosquito settlement, and insecticide use on the islands. The results suggest that historical events of drift rather than mutation are probably the forces generating genetic divergence between these populations, with homogenization of the gene pool by migration being drastically restricted across the ocean. - Microsatellites are relatively short tracts of tandemly repeated DNA sequences of 26 basepairs.13 These loci have been described in recent studies as being powerful markers for population genetics because of their abundance throughout eukaryote genomes, high polymorphism, codominance, and relative ease of scoring.14,15 While they are considered selectively neutral, evidence for constraints acting on some of these loci include biased mutation rate16 or selection on allele size and distribution.1719 However, the forces that shape allele composition at microsatellite loci remain poorly understood and the intensity of constraints they experience may differ from one locus to another. Nevertheless, because of high mutation rates estimated to range between 1022 and 1025 mutations per generation20,21 due mostly to replication slippage (e.g., for a review, see Levinson and Gutman22), those fast-evolving loci have been shown to be appropriate for fine-scale population genetics studies and should provide accurate descriptions of the actual levels of gene flow accessible by indirect studies (see Bossart and others23 and references therein). While An. gambiae has been extensively studied, very little work has been conducted on An. arabiensis population genetics despite its importance as a malaria vector. Furthermore, this species should be a more suitable candidate than its sibling An. gambiae in testing the efficiency of transgenic mosquito control strategies in the fields to reduce malaria burden. Indeed, malaria control by antivectorial means should prove more efficient in low or unstable malaria areas where transmission could be reduced in a sufficient amount to allow subsequent epidemiologic impact.24,25 Such areas, located on the edges of sub-Saharan Africa (dry savannas on the southern border of the Sahara desert, northern South Africa, or African and surrounding island highlands), are generally colonized only by An. arabiensis because the environmental conditions are highly restrictive to the establish 2 La:24D 2 Rd 2 Rb:12 X:1C X:1D 2 R:7B 3 L:45C 3 R:29C 2 R:19 CT GT TGA GT * Data from Zheng and others.34 Data from Zheng and others.35 Data from Besansky and others.36 ment of An. gambiae populations. In the present study, genetic variation at nine microsatellite loci was investigated in four geographically well-isolated An. arabiensis populations from Senegal, Madagascar, Reunion, and Mauritius. The purpose of this work was to assess the following points. 1) Are microsatellite loci isolated from An. gambiae DNA a suitable tool to study the population genetics of its sibling species An. arabiensis? 2) What is the level of genetic variation in An. arabiensis natural populations? 3) Is this variability a global trait over all samples or does it depend on specific characteristics of the population under study? 4) What could be the factors affecting the genetic variability distribution among populations and what is their influence in terms of genetic structuring and gene flow? Results were analyzed in relation to geographic distance including barriers to migration (ocean) and historical events of colonization and extinction on the islands (initial founder effects and bottlenecks due to insecticide use). MATERIALS AND METHODS Study sites. Senegal. The village of Barkedji (158179N, 148539W) is located in the Sahelian region. The rainy season is short, extending from July to October, with little annual variation in the amount of rainfall (300400 mm). An extensive study of malaria vectors ecology and population dynamics in this location showed that the vectors are An. arabiensis and An. gambiae.2 Because no mosquito breeding sites are available during the dry season, malaria transmission is highly seasonal. Madagascar. Fenoarivo (198479S, 468349E) is a village on the high plateau of Madagascar, the largest island in the Indian Ocean (587,000 km2) located 350 km from the east coast of the African continent. At an elevation of 1,235 m, Fenoarivo is surrounded by flooded rice fields. The hot rainy season lasts from November to April with an annual rainfall 59GGCGAGCAGTTCATTCAAGT 39 59CGTCTGGAAGTTTCGTTGAG 39 59CGGAGCAAATCTGAACCGTG 39 59CCTTGGCCACAACAACATCG 39 59GGTTCCTGTTACTTCCTGCC39 59CCGGCAACACAAACAATCGG39 59CACGATGGTTTTCGGTGTGG 39 59ATTTGAGCTCTCCCGGGTG 39 59CAGCGCCTCCATATAGAACG 39 59GATCATTCAGCTGAACCTGC 39 59CTCGATAAATCCCGTCGGTG 39 59GTCGGTTTGAGGTTGTAAAGC 39 59AAAAGTGGTGACCGAGTGAC 39 59ATCTTCAACACTTCAGCACG 39 59ATGTTCCAGAGACGACCCAT 39 59TGTTGCCGGTTTGTTGCTGA 39 59CTGCTGTTGCTGCCAAAATG 39 59AGCTTCACGGAAAGCAAAGG 39 of approximately 1,400 mm. A malaria eradication program based on DDT spraying and chemoprophylaxis was conducted from 1949 until elimination of the disease in the early 1960s, with some local, irregular DDT spraying being continued until 1975 (for a review, see Mouchet and others26). However, malaria was still occurring in certain particular areas in the island, and due to the lack of control measures, the situation worsened until the occurrence of an epidemic of malaria in 19861988. Yearly DDT spraying was then reintroduced in 1993 and is still implemented at the present time. Malaria transmission in Madagascar is carried out by the An. gambiae complex and by An. funestus,27 but An. arabiensis and An. funestus are the only two malaria vectors present on the high plateau.28 Mascarene Islands. Reunion (2,500 km2) and Mauritius (2,000 km2), two islands 240 km apart, belong to the Mascarene archipelago. They are located in the Indian Ocean (20258S, 558E) 800 km and 1000 km, respectively, from the east coast of Madagascar. Mosquitoes were collected in a single location on the northwestern part of Reunion (Etang de Saint Paul), while mosquitoes from Mauritius were collected all over the island (17 locations) and pooled. The annual amount of rainfall ranges from 5,000 mm in upwind locations to 500 mm in (...truncated)