sprouty4 acts in vivo as a feedback-induced antagonist of FGF signaling in zebrafish

Maximilian Frthauer 1 2 Frank Reifers 0 1 Michael Brand 0 1 Bernard Thisse 1 2 Christine Thisse 1 2 0 Max Planck Institute for Cell Biology and Genetics, Dresden. c/o Department of Neurobiology University of Heidelberg Im Neuenheimer Feld 364 D-69120 Heidelberg , Germany 1 Key words: BMP , Sprouty4, FGF3, FGF8, FGFR, ERK, MAPK, Ras, Morpholino, Zebrafish 2 Institut de Genetique et Biologie Moleculaire et Cellulaire, CNRS/INSERM/ULP , BP 163, 67404 Illkirch cedex, CU de Strasbourg , France sprouty4 acts in vivo as a feedback-induced antagonist of FGF signaling in SUMMARY In looking for novel factors involved in the regulation of the fibroblast growth factor (FGF) signaling pathway, we have isolated a zebrafish sprouty4 gene, based on its extensive similarities with the expression patterns of both fgf8 and fgf3. Through gain- and loss-of-function experiments, we demonstrate that Fgf8 and Fgf3 act in vivo to induce the expression of Spry4, which in turn can inhibit activity of these growth factors. When overexpressed at low doses, Spry4 induces loss of cerebellum and reduction in size of the otic vesicle, thereby mimicking the fgf8/acerebellar mutant phenotype. Injections of high doses of Spry4 cause ventralization of the embryo, an opposite phenotype to the dorsalisation induced by overexpression of Fgf8 or Fgf3. Conversely we have shown that inhibition of Spry4 function Throughout embryonic and adult life, members of the fibroblast growth factor (FGF) family of secreted signaling molecules are implicated in the regulation of cell survival, proliferation, migration and differentiation (Fernig and Gallagher, 1994). At early stages of vertebrate embryogenesis FGFs have been shown to be implicated in the induction of the mesoderm (Amaya et al., 1991; Yamaguchi et al., 1994), as well as the establishment of the anteroposterior and dorsoventral body axes (Frthauer et al., 1997; Lamb and Harland, 1995; Partanen et al., 1998). At later stages, FGF signaling is required for various aspects of organogenesis, including the growth and patterning of the brain (Reifers et al., 1998), the initiation and outgrowth of the limb buds (Martin, 1999) and tooth morphogenesis (Thesleff and Sharpe, 1997). Some of the functions of FGFs have been conserved throughout evolution: both in Drosophila and mouse embryos the outgrowth and branching of the respiratory system is dependent on the activity of this signaling pathway (Metzger and Krasnow, 1999). Studies in vertebrates have revealed the existence of at least 20 different FGFs that are characterized by the presence of a conserved 120 amino acid core region. FGFs elicit their through injection of antisense morpholino oligonucleotide leads to a weak dorsalization of the embryo, the phenotype expected for an upregulation of Fgf8 or Fgf3 signaling pathway. Finally, we show that Spry4 interferes with FGF signaling downstream of the FGF receptor 1 (FGFR1). In addition, our analysis reveals that signaling through FGFR1/Ras/mitogen-activated protein kinase pathway is involved, not in mesoderm induction, but in the control of the dorsoventral patterning via the regulation of bone morphogenetic protein (BMP) expression. cellular response through the binding to transmembrane tyrosine kinase FGF receptors (FGFRs). The four existing FGFR genes encode seven receptor isoforms with different binding affinities for the various FGFs (Ornitz et al., 1996). Moreover binding of FGFs to heparan sulfate proteoglycans is crucial for efficient receptor stimulation (Lin et al., 1999). FGF binding induces the dimerisation of FGFRs, therefore allowing the transphosphorylation of several cytoplasmic tyrosine residues. This modification leads to the recruitment and phosphorylation of the lipid-anchored protein FRS2, which then interacts with the SH2 domain-containing adaptor protein Grb2 (Kouhara et al., 1997). Grb2 then allows the binding of the guanine nucleotide exchange factor Sos, which mediates the activation of the membrane-bound monomeric G-protein Ras (Lowenstein et al., 1992). This in turn induces the activation of a kinase cascade comprising Raf, mitogenactivated protein kinase (MAPK) and MAPK kinase (MEK), the last member of which finally enters the nucleus and phosphorylates target transcription factors (Sternberg and Alberola-Ila, 1998). Recent genetic studies in Drosophila have led to the isolation of the novel gene sprouty (spry) which antagonizes FGF signaling during tracheal morphogenesis (Hacohen et al., 1998). Subsequent work has revealed that Spry not only interferes with signaling by FGFRs, but also with signaling by the epidermal growth factor (EGF) receptor, torso and sevenless receptor tyrosine kinases (RTK) (Casci et al., 1999; Kramer et al., 1999; Reich et al., 1999). Spry has been suggested to act as general antagonist of RTK-induced Ras signaling through the interaction with the docking protein Drk (the Drosophila Grb2 homolog) and the GTPase Gap1, which acts as an inhibitor of Ras activation (Casci et al., 1999). Studies in vertebrates have revealed the existence of several spry homologs in mouse and chicken. These genes are expressed in regions of ongoing FGF signaling and can be induced locally through the implantation of beads soaked in recombinant FGF proteins (Chambers et al., 2000; Minowada et al., 1999). Moreover, studies of mouse lung development suggest that, as in Drosophila, Spry acts as an inhibitor of branching morphogenesis (Tefft et al., 1999). In the course of a large-scale in situ hybridization screen of embryonic gene expressions, we have identified a zebrafish sprouty4 homolog, owing to its coexpression with fgf8 and fgf3. We show that Fgf8 and Fgf3 act in vivo to induce the expression of Spry4, which antagonizes their activity by acting downstream of FGFR1. MATERIALS AND METHODS Whole-mount in situ hybridization For spry4, a 720 bp BamHI/XhoI 3 UTR fragment was subcloned in the corresponding sites of pBSKII(+). For fgf3 (Kiefer et al., 1996), a 560 bp 3 UTR fragment was amplified by RT-PCR using the primers GGATCCCTCTCTCTTGACACAGATGG and CTCGAGTTGAGATTGGAAGGGTAG, and subcloned in the BamHI/XhoI sites of pBSKII(+). For probe synthesis, plasmids were linearized with BamHI and RNA transcribed with T7 RNA polymerase. In situ hybridization was performed as described (Thisse and Thisse, http://www-igbmc.u-strasbg.fr/zf_info/zbook/chapt9/9.82.html). CG1061 as well as CB588 were isolated within the course of our large-scale in situ hybridization screen (B.T. and C. T., unpublished). Fragments of zebrafish cDNA coding for FGFR1, FGFR2, FGFR3 and used as probe for in situ were as described (Poss et al., 2000). Constructs encoding constitutively activated FGFR1 and FGFR4 have already been described (Umbhauer et al., 2000). Whole-mount MAPK immunostaining Embryos were fixed for 24 hours in 4% PFA at 4C, dehydrated by 10 minute incubations in 25, 50, 75 and 100% ethanol and stored in 100% ethanol at - 20C. For antibody stainin (...truncated)