Re: Association Between Endothelin Receptor B Nonsynonymous Variants and Melanoma Risk

Re: Association Between Endothelin Receptor B Nonsynonymous Variants 0 1 2 Melanoma Risk 0 1 2 0 Journal of the National Cancer Institute , Vol. 98, No. 17, September 6, 2006 1 DOI: 10.1093/jnci/djj337 The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions , please 2 Affiliations of authors: Division of Molecular Genetic Epidemiology (RKT, AT, KH, RK), Skin Cancer Unit (AT, SU, DS), German Cancer Re- search Center, Heidelberg, Germany; Department of Biosciences and Nutrition, Karolinska Institute, Novum, Huddinge, Sweden (KH, RK). of Molecular Genetic Epidemiology, German Can- cer Research Center , Im Neuenheimer Feld 580, 69120 Heidelberg , Germany ( *German melanoma case patients (n = 462) and ethnically matched control subjects (n = 334). EDNRB = endothelin receptor B; MC1R = melanocortin-1 receptor. Age- and sex-adjusted odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by logistic regression. Adjusted P values (two-sided) were calculated from chi-square tests. A 298-bp fragment containing exon 4 of the EDNRB gene with L277L and S305N polymorphisms was amplified using forward: CGTAAAAATTCTCTCATCCC and reverse:AACAAGAAAAAGGAAATATGC primers and sequenced directly. DNA from six case patients and four control subjects could not be sequenced for exon 4 of the EDNRB gene. ||MC1R gene was amplified as a single 951-bp fragment using primers (forward: GCAGCACCAT GAACTAAGCA and reverse: CAGGGTCACACAGGAACCA). The amplified fragment was sequenced by using two forward (GACGTGATCACCTGCAGCTC and CTGGGCATTTTCTTCCTCTG) and one reverse primers (GGCCATGAGCACCAGCATA). The variants detected in melanoma cases and controls included V60L, D84E, V92M, G104S, L106L, R142H, R151C, I155T, R160W, R163Q, D294H and T314T. The amplification of MC1R gene failed for DNA samples from four case patients and two control subjects. Case patients and control subjects with one or more variants in the MC1R gene. - The known genetic risk factors for malignant melanoma, besides CDKN2A and CDK4 mutations, include variant alleles of the melanocortin-1 receptor (MC1R) gene (1). Recently, Soufir et al. (2) in a study that was based on 137 malignant melanoma patients and 131 ethnically matched control subjects reported an association between nonsynonymous variants in the endothelin receptor B (EDNRB) gene and increased risk of melanoma. They reported six nonsynonymous EDNRB variants in 15 patients compared with two variants in four control subjects. EDNRB promotes migration and proliferation of melanocyte precursors during embryonic development (3). The overexpression of EDNRB in most human melanomas and the shrinkage of tumors in immunocompromised mice and induction of apoptosis upon inhibition of EDNRB suggest a role in disease progression (4,5). Mutations in the gene are associated with several genetic disorders. The most common variant detected by Soufir et al. in 12 melanoma patients and three control subjects, S305N, has previously been reported in Hirschsprung disease (2,6). To extend the study on the role of EDNRB variants in melanoma, we investigated the occurrence of the S305N variant in 462 case patients and 334 ethnically matched control subjects. The case patients were unrelated German melanoma patients (252 men and 210 women; mean age = 57.0 years, range = 792 years). The control subjects were healthy blood donors (228 men and 106 women, mean age = 41.0 years, range = 1878 years). Patients gave informed consent, and the study was approved by the institutional review board of University Hospital, Mannheim, Germany. Exon 4 of the EDNRB gene was amplified using DNA extracted from the blood samples of case patients and control subjects and was screened for the Table 1. Genotype frequencies of EDNRB and MC1R variants in malignant melanoma case patients and control subjects* Case patients, n Control subjects, n OR (95% CI) 1.0 (referent) 0.8 (0.6 to 1.1) 0.8 (0.5 to 1.3) 1.0 (referent) 0.8 (0.3 to 2.5) 1.0 (referent) 1.7 (1.2 to 2.5) S305N (G > A) and the more common L277L (G > A) variant by DNA sequencing. In addition, the entire MC1R gene was screened for variants. Age- and sexadjusted odds ratios (ORs), 95% confidence intervals (CIs), and P values for risk associated with variant genotypes were assessed by using logistic regression. All statistical tests were two-sided, and statistical analyses were carried using SAS version 9.1 software (SAS Institute Inc, Cary, NC). The frequency of heterozygote genotype for the S305N polymorphism in the EDNRD gene was 0.02 in both case patients and control subjects. The variant allele frequency of 0.01 in both case patients and control subjects was similar to that reported by Soufir et al. (2) for control subjects in their study. No case patient or control subject was homozygous for the variant allele. The adjusted odds ratio for risk in S305N polymorphism carriers was 0.8 (95% CI = 0.3 to 2.5; P = .76; Table 1). The frequency of variant A allele for L277L synonymous polymorphism was 0.39 and 0.41 in case patients and control subjects, respectively. The adjusted odds ratio for associated risk in L277L synonymous polymorphism carriers was 0.8 (95% CI = 0.6 to 1.1; P = .20) compared with noncarriers. The presence of one or more MC1R variants was associated with an increased risk of melanoma (OR = 1.7, 95% CI = 1.2 to 2.5; P = .005). In contrast to the results of Soufir et al. (2), our data from a large study did not show any association between melanoma risk and the S305N variant in the EDNRB gene. However, our results did confirm the risk associated with variant alleles in the MC1R gene. We cannot rule out different study populations as a cause of observed differences in results. Moreover, we do not preclude that the association of EDNRB with melanoma occurs through another gene variant or via a different mechanism. REFERENCES (1) Hayward NK. Genetics of melanoma predispo sition. Oncogene 2003;22:305362. (2) Soufir N, Meziani R, Lacapere JJ, Bertrand G, Fumeron F, Bourillon A, et al. Association between endothelin receptor B nonsynonymous variants and melanoma risk. J Natl Cancer Inst 2005;97:1297301. (3) Lahav R. Endothelin receptor B is required for the expansion of melanocyte precursors and malignant melanoma. Int J Dev Biol 2005; 49:17380. (4) Bittner M, Meltzer P, Chen Y, Jiang Y, Seftor E, Hendrix M, et al. Molecular classification of cutaneous malignant melanoma by gene expression profiling. Nature 2000;406:53640. (5) Lahav R, Suva ML, Rimoldi D, Patterson PH, Stamenkovic I. Endothelin receptor B inhibition triggers apoptosis and enhances angiogenesis in melanomas. Cancer Res 2004;64:894553. (6) Auricchio A, Casari G, Staiano A, Ballabio A. Endothelin-B receptor mutations in patients with isolated Hirschsprung disease from a non-inbred population. Hum Mol Genet 1996; 5:3514. Thirumaran et al. raise concerns about the true association of the S305N EDNRB mutation with melanoma risk tha (...truncated)