Role of Interleukin 6 in Innate Immunity to Mycobacterium tuberculosis Infection

Alejandra N. Martinez 2 3 Smriti Mehra 1 2 Deepak Kaushal () 0 2 3 0 Department of Microbiology and Immunology, Tulane University Health Sciences Center , New Orleans, Louisiana 1 Division of Microbiology, Tulane National Primate Research Center , Covington 2 Received 9 July 2012; accepted 24 November 2012; electronically published 28 January 2013. nology, Tulane National Primate Research Center , 18703 Three Rivers Rd, Bldg 20, Covington, LA 70433 3 Divisions of Bacteriology and Parasitology Background. Mycobacterium tuberculosis can grow in the hostile intracellular environment of macrophages by actively evading macrophage-associated antibacterial activities. The stress response factor SigH contributes to this process by modulating -chemokine and interleukin 6 (Il6) expression. Hence, Il6 is of critical importance for acquired immunity against M. tuberculosis infection. Here, we attempted to better characterize the role of Il6 in the immune response to M. tuberculosis infection. Methods. A small interfering RNA-based approach was used to silence expression of the Il6 transcript in host macrophages infected with a wild-type strain of M. tuberculosis or an attenuated mutant strain of M. tuberculosis (Mtb:-sigH). The outcome was measured by the analysis of bacterial burden and transcriptome-wide analysis of host gene expression. Transcriptome results were confirmed via quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Results. Wild type and Mtb:-sigH infection of host macrophages in which Il6 had been silenced resulted in increased expression of interferon-inducible genes, especially those involved in type I interferon signaling. The expression of Ly-6 genes was significantly higher in cells infected with Mtb:-sigH, compared with those infected with the wild-type strain (P < .05). Conclusions. M. tuberculosis regulates host Il6 production to inhibit type I interferon signaling and, consequently, disease progression. Mtb:-sigH is associated with delayed activation of macrophages, compared with the wild-type strain, and with delayed inflammatory stimuli as consequence. These findings have important implications for improving understanding of the mechanisms behind M. tuberculosis virulence and pathogenesis and provide an initial road map to further investigate the mechanisms that may account for the deleterious effects of type I interferons in M. tuberculosis infection. - Resistance to Mycobacterium tuberculosis infection requires the host to restrict bacterial replication via a successful T-helper 1 (Th1) response [1]. Hence, proinflammatory cytokines and chemokines induced by M. tuberculosis are crucial for immunity to tuberculosis. Because macrophages have potent antimicrobial functions, they play an important role in the innate immune response to pathogens and, thus, are essential in shaping adaptive immune responses [2, 3]. Nevertheless, M. tuberculosis can evade the functions of macrophages and actively grow within their hostile intracellular environment [4]. As part of this strategy, M. tuberculosis inhibits phagosome maturation and acidification, interferes with responses to interferon (Ifng), resists antimicrobial agents that damage the bacterial cell envelope, and counters toxic reactive oxygen and nitrogen intermediates [1, 5]. The evasion of these innate immune defenses allows M. tuberculosis to replicate within the host and escape early immune detection. Therefore, regulation of early immune events by pathogens also interferes with the induction of proinflammatory cytokines and, consequently, with the disease outcome [2, 6, 7]. M. tuberculosis can restrict macrophage activation and proinflammatory responses through the stress Table 1. Primer Sequences and PrimerBank Identification (ID) Primer Sequencea PrimerBank IDb Il6 Forward: 5 CCACGGCCTTCC CTACTTC3; reverse: 5 TTGGGAGTGGTATCCTCT GTGA3 18S rRNA Forward: 5 TTGACGGAAGG GCACCACCAG 3; reverse: 5 GCACCACCACCCACGGAATCG 3 Gapdh Forward: 5 CTTTGGCATTGT GGAAGGGCTCAT 3; reverse: 5 ACCAGTGGATGCAGGGAT GATGTT 3 response factor SigH [8]. Transcriptional comparison of infected macrophages demonstrated that the Mtb:-sigH mutant strain induced significantly higher levels of interleukin 6 (Il6) than M. tuberculosis, suggesting its critical importance for acquired immunity against tuberculosis. Il6 is a pleiotropic proinflammatory cytokine, and its increased production is a hallmark of many human chronic inflammatory diseases. Tumor necrosis factor (Tnf ) and Il6 are differentially required for protective immune responses in mice infected with M. tuberculosis. However, despite its importance in mediating inflammation, Il6 is not as essential as tumor necrosis factor for antimycobacterial effector mechanisms [9]. Il6 is critical to resistance against tuberculosis after infection with high doses of intravenously delivered M. tuberculosis, but it is dispensable for the control of mycobacterial growth after low-dose aerosoldelivered infection [1012]. In addition, it has been shown that Il6 is essential for generating protective Th1 immune responses after vaccination with a subunit vaccine against M. tuberculosis [13] but that it has an inhibitory function with respect to Ifng signaling [12]. Hence, we used a small interfering RNA (siRNA)based approach to further characterize the role of Il6 and the components of the macrophage-signaling machinery that regulate intracellular survival of M. tuberculosis. MATERIALS AND METHODS Murine Cell Line and Il-6 siRNA Macrophage cell lines derived from C57BL6/J wild-type and Toll-like receptor 2 (TLR2)knockout mice were obtained from BEI Resources (catalog nos. NR-9456, NR-9457, and NR-9567; Manassas, VA). Cell lines were cultured as adherent cells in Dulbeccos modified Eagles medium supplemented with 10% heat-inactivated fetal bovine serum under a humidified 5% CO2 atmosphere, as recommended by BEI Resources. Four distinct ON-TARGETplus SMARTpool siRNA species targeting different sequences of the Il6 transcript were obtained from Dharmacon (catalog no. L-043739-00-0005). Predesigned siRNA obtained from Life Technologies included GAPDH siRNA (catalog no. AM4624) as a positive control and siRNA with a scrambled sequence (catalog no. 12935200) as a negative control. Infection With M. tuberculosis and Mtb:-sigH Strains The wild-type M. tuberculosis strain CDC1551 and the mutant strain Mtb:-sigH were cultured as previously described [14, 15]. C57BL/6 macrophages were infected with either M. tuberculosis wild-type or its mutant counterpart at a multiplicity of infection of 1:10 and after 4 hours, cells were washed extensively to remove extracellular bacilli [8, 16]. siRNA Transfection Transfection was performed by mixing Il6 siRNA and 1 L of Lipofectamine RNAiMAX (Invitrogen) for 20 minutes at a Oligonucleotide sequences for mouse DNAspecific primers designed by us for quantitative polymerase chain reaction analysis of the specified targets. b PrimerBan (...truncated)