Intracranial Administration of P Gene siRNA Protects Mice from Lethal Chandipura Virus Encephalitis

Citation: Kumar S, Arankalle VA ( Intracranial Administration of P Gene siRNA Protects Mice from Lethal Chandipura Virus Encephalitis Satyendra Kumar 0 Vidya A. Arankalle 0 Bradley S. Schneider, Institut Pasteur, France 0 National Institute of Virology , Pune , India Background: In parts of India, Chandipura Virus (CHPV) has emerged as an encephalitis causing pathogen in both epidemic and sporadic forms. This pediatric disease follows rapid course leading to 55-75% mortality. In the absence of specific treatment, effectiveness of RNA interference (RNAi) was evaluated. Methods and Findings: Efficacy of synthetic short interfering RNA (siRNA) or short hairpin RNA (shRNA) in protecting mice from CHPV infection was assessed. The target genes were P and M genes primarily because important role of the former in viral replication and lethal nature of the latter. Real time one step RT-PCR and plaque assay were used for the assessment of gene silencing. Using pAcGFP1N1-CHPV-P, we showed that P-2 siRNA was most efficient in reducing the expression of P gene in-vitro. Both quantitative assays documented 2logs reduction in the virus titer when P-2, M-5 or M-6 siRNAs were transfected 2hr post infection (PI). Use of these siRNAs in combination did not result in enhanced efficiency. P-2 siRNA was found to tolerate four mismatches in the center. As compared to five different shRNAs, P-2 siRNA was most effective in inhibiting CHPV replication. An extended survival was noted when mice infected intracranially with 100 LD50 CHPV were treated with cationic lipid complexed 5 mg P-2 siRNA simultaneously. Infection with 10LD50 and treatment with two doses of siRNA first, simultaneously and second 24 hr PI, resulted in 70% survival. Surviving mice showed 4logs less CHPV titers in brain without histopathological changes or antibody response. Gene expression profiles of P-2 siRNA treated mice showed no interferon response. First dose of siRNA at 2hr or 4hr PI with second dose at 24hr resulted in 40% and 20% survival respectively suggesting potential application in therapy. Conclusions: The results highlight therapeutic potential of siRNA in treating rapid and fatal Chandipura encephalitis. - Chandipura virus (CHPV), an emerging encephalitis-causing pathogen in India belongs to family Rhabdoviridae and genus vesiculovirus. Outbreaks of CHPV have been reported from the states of Andhra Pradesh [1], Gujarat [2] and Maharashtra [National Institute of Virology (NIV), unpublished data] with mortality varying from 5575% in children. In an endemic area, sporadic disease has also been recorded [3]. CHPV has a negative sense RNA genome of approximately 11.0 Kb encoding 5 different proteins; nucleocapsid (N) protein, phosphoprotein (P) protein, matrix (M) protein, glycoprotein (G) protein and large (L) protein. The P protein has important functions in the virus life cycle, both in transcription and replication [4] RNA interference (RNAi) is a post-transcriptional process triggered by the introduction of double-stranded RNA (dsRNA), which is subsequently cleaved by Dicer into 2123 nt small interfering RNAs (siRNA). The siRNAs are then unwound by RISC (RNA induced silencing complex) in the presence of ATP. The activated RISC binds and degrades target mRNA guided by the single strand of the siRNA [512]. In recent years, RNAi has emerged as a powerful tool for gene silencing with a potential for therapeutic use in viral infections such as Human immunodeficiency virus (HIV) [13] Influenza [14], Respiratory syncytial virus (RSV) [15], SARS coronavirus [16] and Ebola virus [17]. Several studies have shown that the central nervous system (CNS) is also acquiescent to RNAi as in the case of brain cancer [18], Spinocerebellar ataxia [19]. Intracranial injection of siRNA has shown immense potential in suppressing encephalitis caused by two flaviviruses, JEV (Japanese encephalitis virus) and WNV (West Nile virus) [20]. Control of non-segmented negative-strand RNA virus replication in culture cells by siRNA has been well documented [21]. A recent study has shown inhibition of rabies virus replication by multiple artificial microRNAs (amiRNA) in Neuro 2a cells [22]. Considering the recent emergence of a rapidly progressing viral infection leading to encephalitis with high fatality proportion in children from India and the absence of any specific treatment, RNAi based interventions were explored to suppress CHPV infection in mice. Materials and Methods Cells and Virus used in study Human embryonic Kidney (HEK)-293 cells were used for the siRNA studies and Vero E6 cells were used for the plaque assay. AGCAATTGATAAAGAATTCAT Design and synthesis of siRNA All CHPV sequences present in the GenBank [23] and the sequences of the new isolates generated in the lab (NIV, unpublished data) were used to design the siRNA. All siRNAs were designed using HP OnGuard siRNA design. (Table 1 and Fig 1). Four and 8 siRNAs were synthesized for P gene and M gene respectively targeting cDNA (+) strand. Negative control siRNA (ncsiRNA) with no significant homology to any known mammalian gene was used as a non-silencing control in all RNAi experiments and purchased from qiagen (Catalog number 1027280) and negative control plasmid (NCP) was used in shRNA experiments (Ambion, USA). (http://www1.qiagen.com/Products/GeneSilencing/SiRnaDuplexes/ HPGuaranteed.aspx). Transfection of siRNA For the transfection of siRNA, amaxa nucleofactor II device and supplemented kit V solution was used as suggested by the manufacturer. For transfection using HiPerfect reagent, HEK293 cells were seeded 1216 hr before transfection in a six-well plate (16105 per well). Lipid-siRNA complexes were prepared by incubating 100 pmol of siRNA with HiPerfect reagent (QIAGEN, Valencia, CA) in the appropriate volume as recommended by the manufacturer. To determine transfection efficiency, P-2 siRNA tagged with Alexa Fluor-647 was used (Qiagen, Valencia, CA). P gene siRNA validation with pAcGFP1N1-CHPV-P Cells were transfected with P gene siRNA (P-1 to P-4) at a concentration of 100 pmol and 2 mg of target expressing plasmid pAcGFP1N1-CHPV-P. 24 hr post transfection, cells were harvested and flow cytometry and real time one step RT-PCR were carried out. For real time one step RT-PCR, RNA was isolated using RNAeasy minikit (QIAGEN, Valencia, CA) as described by Chandipura Virus 034627, isolated during 2003 Andhra Pradesh epidemic [1] was used throughout the study. Cloning and expression of P gene of CHPV in pAcGFP1N1 P gene of CHPV was amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using PFloF1 (59 TCTCGAGCTCAAGCTCCACCATGGAAGACTCTCAACT AT-39) and PGFPR1 (59-CCGCGGTACCGTCGAATTGAACTGGGGTTCAAG-39) primers without stop codon and cloned into pAcGFP1N1 vector (named pAcGFP1N1-CHPV-P). HEK293 cells were transfected with 2 mg each of pAcGFP1N1 and pAcGFP1N1-CHPV-P. Transfected cells were observed under florescent microscope periodically to chec (...truncated)