Formation of active inclusion bodies induced by hydrophobic self-assembling peptide GFIL8

Wang et al. Microb Cell Fact (2015) 14:88 DOI 10.1186/s12934-015-0270-0 Open Access RESEARCH Formation of active inclusion bodies induced by hydrophobic self‑assembling peptide GFIL8 Xu Wang, Bihong Zhou, Weike Hu, Qing Zhao and Zhanglin Lin* Abstract Background: In the last few decades, several groups have observed that proteins expressed as inclusion bodies (IBs) in bacteria could still be biologically active when terminally fused to an appropriate aggregation-prone partner such as pyruvate oxidase from Paenibacillus polymyxa (PoxB). More recently, we have demonstrated that three amphipathic self-assembling peptides, an alpha helical peptide 18A, a beta-strand peptide ELK16, and a surfactant-like peptide L6KD, have properties that induce target proteins into active IBs. We have developed an efficient protein expression and purification approach for these active IBs by introducing a self-cleavable intein molecule. Results: In this study, the self-assembling peptide GFIL8 (GFILGFIL) with only hydrophobic residues was analyzed, and this peptide effectively induced the formation of cytoplasmic IBs in Escherichia coli when terminally attached to lipase A and amadoriase II. The protein aggregates in cells were confirmed by transmission electron microscopy analysis and retained ~50% of their specific activities relative to the native counterparts. We constructed an expression and separation coupled tag (ESCT) by incorporating an intein molecule, the Mxe GyrA intein. Soluble target proteins were successfully released from active IBs upon cleavage of the intein between the GFIL8 tag and the target protein, which was mediated by dithiothreitol. A variant of GFIL8, GFIL16 (GFILGFILGFILGFIL), improved the ESCT scheme by efficiently eliminating interference from the soluble intein-GFIL8 molecule. The yields of target proteins at the laboratory scale were 3.0–7.5 μg/mg wet cell pellet, which is comparable to the yields from similar ESCT constructs using 18A, ELK16, or the elastin-like peptide tag scheme. Conclusions: The all-hydrophobic self-assembling peptide GFIL8 induced the formation of active IBs in E. coli when terminally attached to target proteins. GFIL8 and its variant GFIL16 can act as a “pull-down” tag to produce purified soluble proteins with reasonable quantity and purity from active aggregates. Owing to the structural simplicity, strong hydrophobicity, and high aggregating efficiency, these peptides can be further explored for enzyme production and immobilization. Keywords: Active inclusion bodies, Hydrophobic self-assembling peptide, Intein-mediated cleavage, Expression and purification coupled tag Background Overexpressed heterologous proteins in recombinant microbial hosts such as Escherichia coli often accumulate as insoluble inclusion bodies (IBs), which are generally considered to be biologically inactive and thus undesirable for protein expression and industrial applications *Correspondence: Department of Chemical Engineering, Tsinghua University, One Tsinghua Garden Road, Beijing 100084, China [1–3]. Numerous efforts have been made to modulate or reduce the formation of IBs [4, 5]. However, over the last decade, the paradigm has completely changed. Several groups have observed that proteins deposited in IBs have biological activities. This was first reported by Worall in 1989 and 2 years later by Tokatlidis [6, 7]. The most universal and commonly used approaches to generate active IBs are to fuse a target protein to an aggregation-prone domain or protein sequence [8–12]. Several “pull-down” partners that drive proteins into active aggregates have © 2015 Wang et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Wang et al. Microb Cell Fact (2015) 14:88 Page 2 of 8 been reported, including a virus capsid protein (VP1), a variant of a human β-amyloid peptide (Aβ(F19D)) [8], a mutant of the maltose-binding protein (MalE31) [9], a cellulose-binding domain from Clostridium cellulovorans (CBDclos) [10], pyruvate oxidase from Paenibacillus polymyxa (PoxB), [11] and the green fluorescent protein (GFP) [12]. More recently, a study has demonstrated that biologically active IBs for the GFP can be obtained through engineering the protein itself [13], but this approach seems to be strongly peptide or protein specific. Active IBs provide unique advantages compared with their soluble counterparts, such as easy separation and purification, greater stability and suitability as immobilized biocatalysis, bioassays, and biomaterials [14–16]. Thus, an increasing amount of attention has been drawn to this line of study [17, 18]. In our previous studies [19, 20], we found three selfassembling amphipathic peptides were able to serve as “pull-down” fusion tags to effectively induce several normally soluble proteins into cytoplasmic active IBs in E. coli, i.e., an alpha-helical octadecapeptide 18A (EWLKAFYEKVLEKLKELF), a beta-strand peptide ELK16 (LELELKLKLELELKLK) [19], and a small surfactant-like peptide L6KD (LLLLLLKD) [20]. Compared with other aggregating fusion partners, these peptides are much smaller in size and structurally simple, and generally have high “pull-down” efficiencies. Subsequently, we have developed a single-step protein purification approach by fusing a cleavable intein molecule between the target protein and the self-assembling peptide [21]. Thus, the target protein can be released into the soluble fraction by intein-mediated cleavage and easily obtained by centrifugation. In this work, we tested a fourth type of peptide, an allhydrophobic self-assembling peptide GFIL8 (GFILGFIL) that can induce active IBs when attached to the carboxyl termini of target proteins. This short peptide is inspired from the tetrapeptide (GFIL) [22], which can form gelphase materials via self-assembly. This is the first study to use a short peptide composed of purely hydrophobic amino acids to induce the formation of active IBs and thereby demonstrates the potential of GFIL8 as a novel IB-inducing fusion tag in vivo. In addition, GFIL8 and its variant GFIL16 can also be successfully applied in the production and purification of proteins with the assistance of the intein molecule. 5′-CCGCTCGAGTCACAGAATGAAACCCAGAAT GAAACCCGGCGTCGGGGTTGG, the restriction sites NdeI and XhoI are underlined) were used to amplify the gene encoding LipA-GFIL8. The amplified LipA-GFIL8 gene was restriction digested with NdeI and XhoI, and inserted into the pET30a (+) (Novagen) (...truncated)