Alu retrotransposons promote differentiation of human carcinoma cells through the aryl hydrocarbon receptor

Published online 15 February 2016 Nucleic Acids Research, 2016, Vol. 44, No. 10 4665–4683 doi: 10.1093/nar/gkw095 Alu retrotransposons promote differentiation of human carcinoma cells through the aryl hydrocarbon receptor Antonio Morales-Hernández1 , Francisco J. González-Rico1 , Angel C. Román2 , Eva Rico-Leo1 , Alberto Alvarez-Barrientos3 , Laura Sánchez4 , Ángela Macia4 , Sara R. Heras4 , José L. Garcı́a-Pérez4 , Jaime M. Merino1 and Pedro M. Fernández-Salguero1,* 1 Departamento de Bioquı́mica y Biologı́a Molecular, Facultad de Ciencias, Universidad de Extremadura, Avenida de Elvas s/n, 06071-Badajoz, Spain, 2 Instituto Cajal, Consejo Superior de Investigaciones Cientı́ficas, Avenida Doctor Arce 37, 28002-Madrid, Spain, 3 Servicio de Técnicas Aplicadas a las Biociencias, Universidad de Extremadura, Avenida de Elvas s/n 06071-Badajoz, Spain and 4 GENYO. Centro de Genómica e Investigación Oncológica: Pfizer/Universidad de Granada/Junta de Andalucı́a, Avda. de la Ilustración 114, PTS Granada, 18016-Granada, Spain ABSTRACT Cell differentiation is a central process in development and in cancer growth and dissemination. OCT4 (POU5F1) and NANOG are essential for cell stemness and pluripotency; yet, the mechanisms that regulate their expression remain largely unknown. Repetitive elements account for almost half of the Human Genome; still, their role in gene regulation is poorly understood. Here, we show that the dioxin receptor (AHR) leads to differentiation of human carcinoma cells through the transcriptional upregulation of Alu retrotransposons, whose RNA transcripts can repress pluripotency genes. Despite the genome-wide presence of Alu elements, we provide evidences that those located at the NANOG and OCT4 promoters bind AHR, are transcribed by RNA polymerase-III and repress NANOG and OCT4 in differentiated cells. OCT4 and NANOG repression likely involves processing of Alu-derived transcripts through the miRNA machinery involving the Microprocessor and RISC. Consistently, stable AHR knockdown led to basal undifferentiation, impaired Alus transcription and blockade of OCT4 and NANOG repression. We suggest that transcripts produced from AHR-regulated Alu retrotransposons may control the expression of stemness genes OCT4 and NANOG during differentiation of carcinoma cells. The control of discrete Alu elements by specific transcription fac- tors may have a dynamic role in genome regulation under physiological and diseased conditions. INTRODUCTION Recent evidences suggest that active transposable elements (TEs) have an important role in defining Human Genome structure and function and, consequently, in controlling development and disease (1,2). Short interspersed nuclear Alu elements (SINE) are a class of TEs highly abundant in the Human Genome that account for nearly 10% of its size (3). Alu retrotransposons derive from the 7SL RNA and are highly abundant in non-coding genomic regions including upstream promoters and gene introns (4,5). Previous studies have shown that global transposon activity varies under diverse cellular conditions; yet, very little is known regarding the mechanisms through which TEs regulate the expression of specific genes (6). In this context, a recent study revealed that an Alu element inserted in human chromosome 9p21 within the long non-coding RNA (lncRNA) ANRIL was needed to trans-regulate genes presumably involved in atherosclerosis (7). In the mouse, Anril lncRNA regulated cell proliferation and differentiation through the Cdkn2A/B gene (8). Notably, TEs are potential carriers of binding sites for transcription factors. Genome-wide analyses have found an enrichment of binding sites for ESR1, TP53, OCT4 (POU5F1), SOX2 and CTCF in human TEs (9–11). In fact, TEs provide up to 25% of the binding sites for the pluripotency regulators OCT4 (POU5F1) and NANOG and for the chromatin remodeler CTCF in both human and mouse embryonic stem (ES) cells (10). Consequently, it appears plausible that TEs assume an important role in the control * To whom correspondence should be addressed. Tel: +34 924 289 422; Fax: +34 924 289 419; Email:  C The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact Received November 13, 2015; Revised February 7, 2016; Accepted February 9, 2016 4666 Nucleic Acids Research, 2016, Vol. 44, No. 10 MATERIALS AND METHODS Antibodies The following antibodies were used: ␤III-tubulin (Santa Cruz Biotechnology sc-58888, clone TUJ-1), GAP43 (Millipore AB-5220), Tau (generous gift of Dr Lorenzo-Benayas, University of Extremadura), GAPDH (Cell Signaling 2118, clone 14C10), OCT4 (Santa Cruz Biotechnology sc-5279, clone C-10), NANOG (AbCam Ab-21624), AGO2 (Millipore 03–110), AHR (ENZO Life Sciences BML-SA210 and Immunostep 130605–1) and ␤-Actin (Sigma A2066). Cells lines and reagents Human embryonic teratocarcinoma NTERA-wt and NTERA-sh cells were cultured in DMEM containing 10% FBS, 100 U/ml penicillin, 100 ␮g/ml streptomycin and 2 mM L-glutamine at 37◦ C and 5% CO2 atmosphere. NTERA-wt and NTERA-sh cell lines were authenticated by DNA profiling using 8 different and highly polymorphic short tandem repeat (STR) loci (German Biological Resource Centre DSMZ). H9 human ES cells were cultured in matrigel-coated culture plates in high glucose Dulbecco’s modified Eagle’s medium (DMEM) knockout medium containing knockout serum replacement, L-glutamine and non-essential aminoacids at 37◦ C in a 5% CO2 atmosphere. Cells were tested to be mycoplasma free using the LookOut Mycoplasma detection kit (Sigma). Protein A/G-plus agarose was from Santa Cruz Biotechnology. The iScriptTM Reverse Transcription Supermix was from Bio-Rad and the R SYBR Select Master Mix was from Life Technologies. The AhR agonist 6-formylindolo[3,2-b]carbazole (FICZ) was from Enzo. Retroviral knockdown of human AHR AHR was knocked-down in NTERA cells by retroviral transduction essentially as described (20,21) using the shRNA sequence 5 TGCTGTTGACAGTGAGCGAGCA ATGAATTTCCAAGGGAAGTAGTGAAGCCAC AGATGTACTTCCCTTGGAAATTCATTGCCTGCCT ACTGCCTCGGA 3 . For rescue experiments, an shRNA was synthesized targeting the 3 UTR region of the human AHR: 5 TGCTGTTGACAGTG AGCGAACTCTTTACCTTTATTGATATTAGTGA AGCCACAGATGTAATATCAATAAAGGTAAAGA GTGTGCCTACTGCCTCGGA 3 . shRNAs sequences were designed using the algorithm available at: http://www. stanford.edu/group/nolan/retroviral systems/retsys.html. Bioinformatic analysis of Alu elements containing AHR binding sites The Human Genome was analyzed for the presence of conserved elements containing an XRE site and an E-box using the algorithm previously described (14). Two of the mos (...truncated)