Directed immobilization of recombinant staphylococci on cotton fibers by functional display of a fungal cellulose-binding domain

FEMS Microbiology Letters 195 (2001) 197^204 www.fems-microbiology.org Directed immobilization of recombinant staphylococci on cotton ¢bers by functional display of a fungal cellulose-binding domain Janne Lehtio«, Henrik Wernërus, Patrik Samuelson, Tuula T. Teeri, Stefan Sta®hl * Department of Biotechnology, Royal Institute of Technology (KTH), SE-100 44 Stockholm, Sweden Abstract The immobilization of recombinant staphylococci onto cellulose fibers through surface display of a fungal cellulose-binding domain (CBD) was investigated. Chimeric proteins containing the CBD from Trichoderma reesei cellulase Cel6A were found to be correctly targeted to the cell wall of Staphylococcus carnosus cells, since full-length proteins could be extracted and affinity-purified. Furthermore, surface accessibility of the CBD was verified using a monoclonal antibody and functionality in terms of cellulose-binding was demonstrated in two different assays in which recombinant staphylococci were found to efficiently bind to cotton fibers. The implications of this strategy of directed immobilization for the generation of whole-cell microbial tools for different applications will be discussed. ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Surface display; Cellulose-binding domain; Directed immobilization; Staphylococcus carnosus 1. Introduction Immobilized microorganisms have a long tradition, for example in waste water treatment (in trickling ¢lters) and food biotechnology (e.g. Acetobacter in vinegar production), and in such applications the microorganisms are typically immobilized by simple adsorption methods [1]. Also in modern biotechnology immobilized microorganisms are used in di¡erent applications, including the creation of whole-cell biosensors [2] or bacterial bioadsorbents [3,4]. In the ¢eld of biocatalysis, immobilized enzymes have been investigated extensively for decades [5], and a major problem has been that the enzyme activity often is decreased upon immobilization [6]. A strategy to avoid this that has been investigated is to instead immobilize a bacterium overexpressing the particular enzyme of interest, and di¡erent strategies to obtain immobilization have been evaluated [7]. In this context, bacterial surface dis- * Corresponding author. Tel. : +46 (8) 790-64-97; Fax: +46 (8) 24-54-52; E-mail : Abbreviations : ABP, albumin-binding protein ; CBD, cellulose-binding domain; HSA, human serum albumin; PBS, phosphate-bu¡ered saline; PBST, phosphate-bu¡ered saline with Tween; SpA, Staphylococcus aureus protein A play of also the enzyme for improved accessibility has been considered advantageous [7]. Straightforward methods for directed immobilization of microorganisms onto inexpensive matrices have been suggested to be favorable as compared to immobilization by aggregation, chemical cross-linking or entrapment [1]. Staphylococcus carnosus is traditionally widely used in food biotechnology, e.g. as starter culture for the fermentation of meat and ¢sh products [8]. Go«tz and coworkers have developed a host^vector system for recombinant protein production in S. carnosus [9], and this expression system was for example used for lipase production in a dialysis fermentor with a product yield of 230 mg l31 [10]. S. carnosus has a very low extracellular proteolytic activity [9], and is therefore an attractive host organism for recombinant protein production. A system for surface display of heterologous proteins on S. carnosus was developed [11], and this system has been extensively investigated as a system for live mucosal delivery of subunit vaccines [12^15]. Furthermore, the S. carnosus surface display system has been used to develop staphylococci with improved binding to Ni2‡ and Cd2‡ ions, and such bacteria have been discussed as interesting bioadsorbents in biosensor or environmental applications [16]. S. carnosus cells with surface-displayed heterologous enzymes have also been described as a new type of microbial biocatalyst [17]. In addition, functional single-chain antibody frag- 0378-1097 / 01 / $20.00 ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 0 0 ) 0 0 5 6 2 - 0 FEMSLE 9771 7-2-01 Received 8 December 2000; accepted 18 December 2000 198 J. Lehtio« et al. / FEMS Microbiology Letters 195 (2001) 197^204 2. Materials and methods 2.1. Bacterial strains and plasmids Escherichia coli strain RRIvM15 [29] was used as bacterial host during the plasmid constructions. The S. carnosus strain TM300 [9] was used for surface expression of a heterologous CBD from T. reesei Cel6A. The general S. carnosus surface display vector pSPPmABPXM [11] was used for the construction of the expression vectors encoding the CBD. The preparation and transformation of protoplasts from S. carnosus cells were performed as described earlier [30]. 2.2. Construction of the CBD surface display vector The gene fragment encoding the CBD of T. reesei Cel6A was generated by PCR ampli¢cation using the synthetic oligonucleotides 5P-AGGGGGATCCGGGTGCTAACCCACCGGGTACTACTACTACTTCTCGCCCGGCTACCACTACCGGCTCCTCCCCTGATCAGGCTTGCTCAAGCGTCTGGGGC-3P and 5P-GGGGGTCGACTGAGGTCCGGGAGAGCTTCCAGT-3P and vector pSI-T21 [31] as template. The upstream primer introduced by its non-complementary 5P-end a linker region encoding 23 amino acids upstream of CBD, and the downstream primer annealed in a linker region in the template, thus introducing a linker corresponding to 24 amino acids downstream of the CBD. Sequences for these linker regions were derived from the natural Cel6A and Cel7A linkers [31]. The generated PCR product was cleaved with BamHI and SalI and ligated to plasmid pSPPmABPXM [11], previously digested with the same enzymes. The nucleotide sequences of the introduced gene fragment, encoding the CBD, were veri¢ed using solid-phase DNA sequencing [32]. The constructed plasmid pSPPCBDABPXM was used for transforming S. carnosus protoplasts, and the resulting recombinant staphylococci will for simplicity be denoted Sc:CBD. 2.3. Extraction and puri¢cation of the chimeric surface proteins Extraction of the chimeric proteins from the cell wall of the recombinant S. carnosus was performed essentially as previously described [11]. Brie£y, cells harboring the parental vector pSPPmABPXM, hereinafter denoted Sc:ABP, or the recombinant staphylococcal strain Sc:CBD, respectively, were grown at 37³C in 50 ml tryptone soy broth medium (TSB, Difco, Detroit, MI, USA), supplemented with yeast extract (5 g l31 , Difco) and chloramphenicol (10 mg l31 ), until OD578 nm reached W1. Cells were washed twice in phosphate-bu¡ered saline (PBS) with 0.05% Tween 20 (PBST) and subjected to a cell wall degrading treatment using lysostaphin (Sigma, St. Louis, MO, USA). The cell pellets were dissolved in 6 ml of SMM solution (1 M sucrose, 40 mM maleic acid and 40 mM MgCl2 (pH 6.5)) (...truncated)