Comparative study of IDH1 mutations in gliomas by immunohistochemistry and DNA sequencing

Neuro-Oncology 15(6):718 – 726, 2013. doi:10.1093/neuonc/not015 Advance Access publication March 13, 2013 N E U RO - O N CO LO GY Comparative study of IDH1 mutations in gliomas by immunohistochemistry and DNA sequencing Departments of Pathology (S.A., M.C.S., P.J., P.P., V.S., C.S.), Biochemistry (K.C), and Neurosurgery (A.S., S.S.K., A.K.M.), All India Institute of Medical Sciences, Delhi, India; All India Institute of Medical Sciences, New Delhi (P.J.); and Institute of Genomics and Integrative Biology, Delhi, India (P.J.) Background. Mutations involving isocitrate dehydrogenase 1 (IDH 1) occur in a high proportion of diffuse gliomas, with implications on diagnosis and prognosis. About 90% involve exon 4 at codon 132, replacing amino acid arginine with histidine (R132H). Rarer ones include R132C, R132S, R132G, R132L, R132V, and R132P. Most authors have used DNA-based methods to assess IDH1 status. Preliminary studies comparing imunohistochemistry (IHC) with IDH1-R132H mutation-specific antibodies have shown concordance with DNA sequencing and no cross-reactivity with wild-type IDH1 or other mutant proteins. The present study compares results of IHC with DNA sequencing in diffuse gliomas. Materials and methods. Fifty diffuse gliomas with frozen tissue samples for DNA sequencing and adequate tissue in paraffin blocks for IHC using IDH1-R132H specific antibody were assessed for IDH1 mutations. Results. Concordance of findings between IHC and DNA sequencing was noted in 88% (44/50) cases. All 6 cases with discrepancy were immunopositive with DIA-H09 antibody. While in 3 of these 6 cases, DNA sequencing failed to reveal any mutations, R132L (arginine replaced by leucine) mutation was found in the rest 3 cases. Interestingly, of the immunopositive cases, 46.6% (14/30) showed immunostaining in only a fraction of tumor cells. Conclusions. IHC is an easy and quick method of detecting IDH1-R132H mutations, but there may be some discrepancies between IHC and DNA sequencing. Although Received May 2, 2012; accepted January 22, 2013. Corresponding Author: Mehar C. Sharma, MD, Department of Pathology, All India Institute of Medical Sciences, New Delhi 110029, India (). there were no false-negative cases, cross-reactivity with IDH1-R132L was seen in 3, a finding not reported thus far. Because of more universal availability of IHC over genetic testing, cross-reactivity and staining heterogeneity may have bearing over its use in detecting IDH1R132H mutation in gliomas. Keywords: diffuse gliomas, DNA sequencing, IDH1R132H, IDH1-R132L, immunohistochemistry. T he IDH1 gene on chromosome 2q33.3 encodes for isocitrate dehydrogenase 1 (IDH1), located in the cytoplasm and the peroxisomes. This enzyme catalyzes NADPH production via oxidative decarboxylation of isocitrate to alpha-ketoglutarate in the Krebs citric acid cycle.1 In 2008, for the first time, Parsons et al introduced to the medicine world the role of IDH1 in the pathogenesis of glioblastoma multiforme (GBM). In their genome-wide sequencing analysis, recurrent somatic mutations specifically involving the amino acid arginine at position 132 were detected in 12% of the GBM specimens.2 Subsequent studies have shown that IDH1 mutation is an early step in gliomagenesis and has been reported to occur in grades II and III astrocytomas, oligodendrogliomas (OG), oligoastrocytomas (OA), and secondary GBM.3 – 12 Hartmann et al, in their analysis of 1010 diffuse glioma tumors, demonstrated that most cases of diffuse astrocytomas (DA; 72.7%, 165/227), anaplastic astrocytomas (AA; 64.0%, 146/228), OG (82.0%, 105/128), anaplastic oligodendrogliomas (AOG; 69.5%, 121/174), OA (81.6%, 62/76), and anaplastic oligoastrocytomas (AOA; 66.1%, 117/177) had IDH1 mutations.13 Of importance, these mutations appear to be specific for these tumors as primary GBM, pilocytic astrocytoma World Health Organization (WHO) grade I and other central # The Author(s) 2013. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: . Shipra Agarwal, Mehar Chand Sharma, Prerana Jha, Pankaj Pathak, Vaishali Suri, Chitra Sarkar, Kunzang Chosdol, Ashish Suri, Shashank Sharad Kale, Ashok Kumar Mahapatra, and Pankaj Jha Agarwal et al.: False-positive H09 in IDH1-R132L mutated gliomas Materials and Methods Tumor Specimens Tumor samples were obtained fresh at the time of surgery from the operation theatre of the Neurosurgery Department at the All India Institute of Medical Sciences, New Delhi, India. All experiments using the human samples were approved by the ethical committee of our institution. There were 8 DA (WHO grade II), 7 AA WHO grade III, 20 GBMs WHO grade IV, 5 grade II OG, 4 AOG, 3 grade II OA, and 3 AOA. Portions of resected tumors were snap-frozen in liquid nitrogen and stored at -808C until use, and the rest of the tissue was formalin-fixed and paraffin-embedded for routine histopathology and IHC. The hematoxylin and eosin (H&E) –stained slides were reviewed by 4 independent neuropathologists (M.C.S., S.A., V.S., and C.S.), who were not aware of the results of the genetic analysis, and consensus diagnoses were made according to WHO classification (2007).37 Clinical parameters, including age, sex, duration of symptoms, and relevant clinical history, of all the patients were recorded. Cases of GBM were classified as primary if there was no history and histomorphological evidence of a diffuse or anaplastic glial tumor and when the duration of symptoms was ,3 months. A case was categorized as secondary GBM only if there was a history of surgery for lower grade precursor tumors.38,39 Thus, there were 15 primary and 5 secondary GBM cases. Tissue Procurement and DNA Preparation Frozen tumor specimens were embedded in freezing medium, sectioned at 5 mm, and stained with H&E. Subsequent 15 serial sections of 40 mm were taken separately for DNA isolation and stored immediately in liquid nitrogen cooled vials. Flanking sections measuring 5 mm were analyzed histologically for presence of adequate tumor tissue, to look for areas of necrosis and normal cerebral cortex. Those sections where the flanking H&E sections showed tumor content .80%, with none or minimal necrosis and no normal tissue were used for DNA extraction. DNA from the tumor tissue was extracted using Genelute mammalian DNA isolation Kit (M/s. Sigma Aldrich, St. Louis, MO) according to the manufacturer’s protocol. IDH1 Mutational Analysis Mutations in exon 4 of IDH1 were determined by direct sequencing in all the cases. Primer sequences used were forward 5′ AATGAGCTCTATATGCCATCACTG3′ and reverse 5′ TTCATACCTTGCTTAATGGGTGT3′ . PCR amplification was performed in a total of 10 mL reaction mixture containing 50 ng of tumor DNA, 1 mL of 10× PCR buffer, 0.8 mL of 10 mM dNTPs, 0.25 mL of each forward and reverse primers, and 0.2 mL of AmpliTaq Gold PCR Master Mix (Applied Biosystems, Inc., Foster City, CA). Initial denaturation (...truncated)