Phylogenetic analyses of the rbcL sequences from haptophytes and heterokont algae suggest their chloroplasts are unrelated.

Phylogenetic Analyses of the &CL Sequences from Haptophytes Heterokont Algae Suggest Their Chloroplasts are Unrelated Niels Daugbjerg” and and Robert A. Andersen”f *Department of Phycology, Boothbay Harbor, Maine University of Copenhagen, Denmark; and TBigelow Laboratory for Ocean Sciences, West Introduction Members of the algal class Haptophyceae were originally classified in the Chrysophyceae (Pascher 1913, pp. 43, 48-49; Bourrelly 1957, pp. 232-234), but as ultrastructural data accumulated, they were placed in their own class (Christensen 1962, pp. 72-74). Since receiving their independent status, additional ultrastructural data (Hibberd 1976) and molecular data (e.g., Bhattacharya et al. 1992; Leipe et al. 1994) have brought into question any evolutionary relationship between the Haptophyceae and the Chrysophyceae. The Chrysophyceae have a well-supported evolutionary relationship with other heterokont algae (=chromophyte algae), but the closest relative for the Haptophyceae remains unresolved. The morphological and biochemical characters that are unique to the Haptophyceae or are shared with other protistan groups are described elsewhere (e.g., Hibberd 1976; Andersen 1991; Leipe et al. 1994; Saunders et al. 1995), but despite this knowledge, no consensus classification or phylogenetic hypothesis for the Haptophyceae has been reached. Because many of the shared characters (synapomorphies) are either chloroplast features or associated with chloroplasts, we compared gene sequences encoding the large subunit of ribulose- 1,5-bisphosphate carboxylase/oxygenase (&CL) Key words: chromophytes, haptophytes, heterokont logeny, plastid evolution, &CL, red algae, RuBisCo. algae, phy- Address for correspondence and reprints: Niels Daugbjerg, Department of Phycology, University of Copenhagen, (dster Farimagsgade 2D, DK-1353 Copenhagen K, Denmark. E-mail: . Mol. Bid. Evol. 14( 12): 1242-l 25 1. 1997 0 1997 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038 1242 Using the large subunit of RuBisCo (&CL) sequences from cyanobacteria, proteobacteria, and diverse groups of algae and green plants, we evaluated the plastid relationship between haptophytes and heterokont algae. The &CL sequences were determined from three taxa of heterokont algae (Bumilleriopsis jiliformis, Pelagomonas calceolata, and Pseudopedinella elastica) and added to 25 published sequences to obtain a data set comprising 1,434 unambiguously aligned sites (-98% of the total rbcL gene). Higher levels of mutational saturation in third codon positions were observed by plotting the pairwise substitutions with and without corrections for multiple substitutions at the same site for first and second codon positions only and for third positions only. In accordance with this finding phylogeny reconstructions were completed by omitting third codon positions, thus using 956 bp in weightedparsimony and maximum-likelihood analyses. The midpoint-rooted phylogenies showed two major clusters, one containing cyanobacteria, glaucocystophytes, a phototrophic euglenoid, chlorophytes, and embryophytes (the green lineage), the other containing proteobacteria, haptophytes, red algae, a cryptophyte, and heterokont algae (the nongreen lineage). In the nongreen lineage, the haptophytes formed a sister group to the clade containing heterokont GuiZZardia theta. This branching pattern was well supported in terms of algae, red algae, and the cryptophyte bootstrap values in weighted-parsimony and maximum-likelihood analyses (100% and 92%, respectively). However, the phylogenetic relationship among red algae, heterokonts, and a cryptophyte taxon was not especially well resolved. A four-cluster analysis was performed to further explore the statistical significance of the relationship between proteobacteria, red algae (including and excluding GuiZZardia theta), haptophytes, and heterokont algae. This test strongly favored the hypothesis that the heterokonts and red algae are more closely related to each other than either is to proteobacteria or haptophytes. Hence, this molecular study based on a plastid-encoded gene provides additional evidence for a distant relationship between haptophytes and the heterokont algae. It suggests an evolutionary scenario in which the ancestor of the haptophyte lineage engulfed a phototrophic eukaryote and, more recently, the heterokont lineage became phototrophic by engulfing a red alga. from various algal lineages in an attempt to resolve the phylogeny of the Haptophyceae and, in a broader sense, to resolve the relationships of algal groups. As already shown (e.g., Morden et al. 1992; U&a and Shibuya 1993; McFadden, Gilson, and Waller 1995), r&L gene comparisons suggest a biphyletic origin of phototrophic eukaryotes. The rbcL gene of the green algae/plant lineage, glaucocystophytes, and phototrophic euglenoids is derived from cyanobacteria and form one rbcL lineage; the second rbcL gene lineage consists of the nongreen algae and is derived from proteobacteria. This scenario for the evolution of the rbcL gene is well supported in terms of bootstrap values but is opposed by molecular phylogenies based on other chloroplast-encoded genes like psbA, t&A (Morden et al. 1992; Delwiche, Kuhsel, and Palmer 1995), atpB (Douglas and Murphy 1994), GAPDH (Martin et al. 1993), ClpC (Clarke and Eriksson 1996), and SSU rDNA (Bhattacharya and Medlin 1995; Helmchen, Bhattacharya, and Melkonian 1995). Phylogenies based on these genes suggest that there was a single cyanobacterial ancestor of plastids. A number of hypotheses have been suggested to explain the apparently contradictory results. For example, (1) a lateral gene transfer of the rbcLS genes may have occurred from a proteobacteria into the ancestor that gave rise to the nongreen plants; (2) a lateral transfer of the rbcLS operon may have occurred into the cyanobacterial ancestor that gave rise to the nongreen plants; or (3) two rbcLS operons may have been present in a cyanobacterial-like ancestor (that gave rise to plastids) and different copies were re- Plastid Evolution in Haptophytes and Heterokont Algae Primer Seauence 5’-3’ 1243 Table 1 Oligonucleotide Primer Sequences Used to Amplify and Sequence Heterokont Algae Primer DPrbcLl ND&L2 ND&L3 ND&L4 ND&L5 ND&L6 Code for Primers Forward Primer Sequence (12-6). ......... (34-53) ........ (43-5 8) ........ (342-356) ...... (635-650) ...... (953-967) ...... Nom-Numbers C); D (m/G); 5’-3’ Primer Code for Reverse Primers AAGGAGGAADHHATGTCT AAAAGTGACCGTTATGAATC CGTTACGAATCTGGTG AGGTTCACTAGCTAA CACAACCATTCATGCG GTAAATGGATGCGTA (23-3; rbcS) (1232-1212). (1226-1212). (983-969). 1 (835-820). (527-514). in parentheses refer to the position of the rbcL gene of the brown alga Pilayella ........ ....... ....... ........ ........ ........ littoralis. AAASHDCCTTGTGTWAGTYTC CCAATAGTACCACCACCAAAT GTACCACCACCAAAT TGGTCAACACCAGCC CAGTGTAACCAATTAC GCACCTAATAGTGG Abbreviations (IUPAC code (...truncated)