Investigating affinity-maturation strategies and reproducibility of fluorescence-activated cell sorting using a recombinant ADAPT library displayed on staphylococci

Protein Engineering, Design & Selection, 2016, vol. 29 no. 5, pp. 187–195 doi: 10.1093/protein/gzw006 Advance Access Publication Date: 15 March 2016 Original Article Original Article Investigating affinity-maturation strategies and reproducibility of fluorescence-activated cell sorting using a recombinant ADAPT library displayed on staphylococci Mikael Åstrand1, Johan Nilvebrant1,2, Mattias Björnmalm1,3, Sarah Lindbo1, Sophia Hober1, and John Löfblom1,* 1 Division of Protein Technology, School of Biotechnology, KTH Royal Institute of Technology, Stockholm, Sweden, Present address: Centre for Cellular and Biomolecular Research, The Donnelly Centre, University of Toronto, Toronto, Ontario, Canada, and 3Present address: Department of Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, Victoria, Australia 2 *To whom correspondence should be addressed. E-mail: Edited by Shohei Koide Received 30 September 2015; Revised 22 January 2016; Accepted 12 February 2016 Abstract During the past decades, advances in protein engineering have resulted in the development of various in vitro selection techniques (e.g. phage display) to facilitate discovery of new and improved proteins. The methods are based on linkage between genotype and phenotype and are often performed in successive rounds of selection. Since the resulting output depends on the selection pressures used and the applied strategy, parameters in each round must be carefully considered. In addition, studies have reported biases that can cause enrichment of unwanted clones and/or low correlation between abundance in output and affinity. We have recently developed a selection method based on display of protein libraries on Staphylococcus carnosus and isolation of affinity proteins by fluorescence-activated cell sorting. Here, we compared duplicate selections for affinity maturation using equilibrium binding at different target concentrations and kinetic off-rate selection. The results showed that kinetic selection is efficient for isolation of high-affinity binders and that equilibrium selection at subnanomolar concentrations should be avoided. Furthermore, the reproducibility of the selection was high and a clear correlation was observed between enrichment and affinity. This work reports on the reproducibility of bacterial display in combination with FACS and provides insights into selection design to help guide the development of new affinity proteins. Key words: ADAPT, bacterial display, directed evolution, FACS, selection strategy Introduction Several directed evolution methods have been developed for combinatorial engineering of affinity proteins. They typically share the property of physical linkage of the protein-encoding gene and its polypeptide product, usually mediated by a host organism (e.g. in phage or bacterial display), to enable isolation of the target-binding proteins and subsequent propagation of the associated genes. Phage display has been the most widely used method for engineering of new affinity reagents, partly due to its straightforward workflow and efficient display of a wide range of different proteins (Chan et al., 2014). Display on the surface of yeast or bacteria are attractive alternatives because fluorescence-activated cell sorting (FACS) can be © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: 187 M.Åstrand et al. 188 These Z domains have a high-affinity for IgG, which allows for monitoring of the surface expression levels on individual cells in a flow cytometer. The cell-surface expression on staphylococcal cells is facilitated by a signal peptide at the N-terminus, which leads to secretion, and a C-terminal region including a LPETG motif that anchors the protein to the cell wall peptidoglycan by an endogenous sortase (Wernérus and Ståhl, 2002). The expression is under control of a constitutive lipase promoter from S. hyicus. Assuming that no biases exist, clones should be selected based on the ratio of amount of bound antigens per displayed binding proteins and varying the antigen concentration should enable discrimination between clones. Thus, there should be a correlation between clonal enrichment and binding affinity. VanAntwerp and Wittrup (2000) and Löfblom et al. (2005) have shown that it is practically possible to distinguish between two clones with very similar affinities. Here, we sought to investigate the staphylococcal surface display platform for biases that could potentially hamper a selection. An affinity-maturation library based on previously engineered ADAPT binders for the human epidermal growth factor receptor 3 (ERBB3) was constructed and used to select candidates using FACS. ERBB3 is implicated in the progression of numerous cancers and is a potential therapeutic target (Zhang et al., 2015). Two duplicate selections were separately performed and compared to evaluate the sequence agreement in the outputs of the different rounds of selection. The replicates from the successful sortings showed a large overlap between the output sequences, demonstrating that the method has a high reproducibility. Moreover, characterization of the output revealed that employing equilibrium selection at subnanomolar target concentrations was suboptimal for enrichment of high-affinity binders, but the kinetic selection resulted in a strong enrichment of in particular one dominating clone that indeed demonstrated the slowest dissociation rate. The results presented here reveal for the first time the reproducibility of bacterial display in combination with FACS for isolation of affinity proteins and include a quantitative assessment of the outcome from using kinetic screenings compared with equilibrium screenings and hence offers insights for optimally designing selection strategies in the future. Materials and methods Library assembly Based on earlier candidates binding to ERBB3 isolated from a naïve ADAPT library (Nilvebrant et al., 2013), an affinity-maturation library was designed where the same 11 positions were targeted for randomization using degenerate codons corresponding to amino acids with high prevalence in the first-generation candidates (Fig. 1a and Supplementary Fig. S1). The total size of the library was calculated to 4.4 × 106 protein variants and 1.8 × 107 gene variants. The library was encoded by a 189-bp ultramer oligonucleotide (Integrated DNA Technologies, IDT, San Diego, CA, USA) with the sequence 5′-CAGG ATCCTCTCGAGGATGAAGCCGTCGACGCGAATTCATTAGC TASKGCTAAAAVAKTAGCTCTGYACDTKCTTGACVNKARAGG AGTAAGTGACTATTACAAGGATCAATCGATAAAGCCAAAACT GTTGAAGGAGTACDKGCACTGDYAMKCGAAATTTTAVBAG CATTACCCGCTAGCTTTCCG-3′. The oligo was assembled and amplified by polymerase chain reaction (PCR) with Phusion polymerase (New England Biolabs (NEB), Ipswich, MA, USA) using external primers incorporating restriction sites XhoI and NheI starting with 100 pmol oligo. The construct was digested over night at 37°C using restriction en (...truncated)