Functional and Anatomical Identification of a Vesicular Transporter Mediating Neuronal ATP Release

Cerebral Cortex May 2012;22:1203--1214 doi:10.1093/cercor/bhr203 Advance Access publication August 1, 2011 Functional and Anatomical Identification of a Vesicular Transporter Mediating Neuronal ATP Release Max Larsson1, Keisuke Sawada2, Cecilie Morland1, Miki Hiasa2, Lasse Ormel1, Yoshinori Moriyama2 and Vidar Gundersen1,3 1 Department of Anatomy and Centre for Molecular Biology and Neuroscience, University of Oslo, N-0317 Oslo, Norway, Department of Membrane Biochemistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama 700-8530, Japan and 3Department of Neurology, Oslo University Hospital, N-0424 Oslo, Norway 2 Address correspondence to Vidar Gundersen, Department of Anatomy and Centre for Molecular Biology and Neuroscience, University of Oslo, PO Box 1105 Blindern, N-0317 Oslo, Norway. Email: . Keywords: exocytosis, neurotransmitter, purinergic, ultrastructure, uptake ATP exerts its transmitter effects through activation of ionotropic (P2X) and metabotropic (P2Y) receptors. Both P2X and P2Y receptors are widely distributed in neural tissue (Nörenberg and Illes 2000; Fields and Burnstock 2006). P2X receptor-mediated excitatory synaptic transmission has been demonstrated in several regions of the central nervous system (Edwards et al. 1992; Bardoni et al. 1997; Pankratov et al. 1998, 2002; Mori et al. 2001). In the hippocampus (Pankratov et al. 1998, 2006), as well as in cortex (Pankratov et al. 2002, 2003, 2007), results from electrophysiological studies have suggested that ATP is coreleased with glutamate. A recent study showed that ATP is released during stimulation of glutamatergic neuronal pathways (Jourdain et al. 2007). However, it is not clear whether ATP and glutamate reside in the same nerve terminals, let alone in the same synaptic vesicle pools. Identification of cellular elements that may release ATP has previously been hampered by lack of ATP-specific antibodies. However, such information can now be obtained using antibodies against VNUT. Here, we use anatomical, biochemical, and functional approaches to investigate the vesicular localization and release of ATP in hippocampal neurons. Introduction Materials and Methods Extracellular ATP has a multifaceted role as a signaling molecule in intercellular communication. In the nervous system, gliaderived ATP has been widely implicated as an extracellular messenger and as a precursor of adenosine in glia-to-glia and gliato-neuron interaction (Koizumi et al. 2005). It is furthermore known that ATP may act as an excitatory neurotransmitter in several brain regions, including the hippocampus (Pankratov et al. 1998, 2006; Mori et al. 2001; Fields and Burnstock 2006). Considerable effort has been devoted to attempts at clarifying the mechanism of release of ATP from glial cells (Stout et al. 2002; Kang et al. 2008; Liu, Sabirov, et al. 2008; Liu, Touchiev, et al. 2008), although controversy regarding this issue remains (Hamilton and Attwell 2010). By contrast, how ATP is released from central neurons has not been well studied. A vesicular nature of neuronal ATP release was first indicated by observations of calcium-dependent release of ATP from whole-brain synaptosomes (White 1978) and several types of brain slice preparation, including hippocampal slices (Wieraszko et al. 1989; Cunha et al. 1996). Furthermore, ATP is taken up by isolated synaptic vesicles (Gualix et al. 1999). Recently, a vesicular nucleotide transporter (VNUT) capable of transporting ATP into vesicles was identified (Sawada et al. 2008). VNUT was shown to be present in the brain (Sawada et al. 2008), but its cellular and subcellular distribution is not known. Expression and Purification of Mouse VNUT A cDNA-encoding mouse VNUT (mVNUT) was cloned (Sawada et al. 2008). Recombinant baculovirus containing mVNUT cDNA were constructed using the Bac-to-Bac baculovirus expression system (Invitrogen) according to the manufacturer’s protocol. mVNUT cDNA was amplified by polymerase chain reaction (PCR) using the primers 5#CACCATGCCATCCCAGCGCTCTAGC-3# and 5#-TTAGAGTCCTCATGAGTGG-3#. High Five cells (1 3 107 cells/10 cm dish) were grown at 27
C in Express Five medium (Invitrogen) supplemented with 2 mM Lglutamine and 10 lg/mL gentamicin. Cells were infected by recombinant baculoviruses at a multiplicity of infection of 2, cultured for 48 h for High Five cells and harvested for membrane preparation. High Five cells (1--2 3 108 cells) were suspended in a 20 mM Tris--HCl buffer (pH 8.0) containing 0.1 M potassium acetate, 10% glycerol, 0.5 mM dithiothreitol, 10 lg/mL pepstatin A, and 10 lg/mL leupeptin and disrupted by sonication with a TOMY UD200 tip sonifier. Cell lysates were centrifuged at 700 3 g for 10 min to remove debris, and the resultant supernatant was centrifuged at 160 000 3 g for 1 h. The pellet (membrane fraction) was suspended in buffer containing 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS)--Tris (pH 7.0), 10% glycerol, 10 lg/mL pepstatin A, and 10 lg/mL leupeptin to a concentration of approximately 1.5 mg protein/ mL. The membrane fraction was solubilized with 2% octylglucoside. After centrifugation at 260 000 3 g for 30 min, the supernatant was added to 1 mL of Ni-NTA Superflow resin (Qiagen). The resin was incubated for 4 h at 4
C and washed with 10 mL of 20 mM MOPS--Tris (pH 7.0) containing 5 mM imidazole, 20% glycerol, and 1% octylglucoside in a column. mVNUT was eluted from the resin with 3 mL of the same buffer  The Author 2011. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: ATP is known to be coreleased with glutamate at certain central synapses. However, the nature of its release is controversial. Here, we demonstrate that ATP release from cultured rat hippocampal neurons is sensitive to RNAi-mediated knockdown of the recently identified vesicular nucleotide transporter (VNUT or SLC17A9). In the intact brain, light microscopy showed particularly strong VNUT immunoreactivity in the cerebellar cortex, the olfactory bulb, and the hippocampus. Using immunoelectron microscopy, we found VNUT immunoreactivity colocalized with synaptic vesicles in excitatory and inhibitory terminals in the hippocampal formation. Moreover, VNUT immunolabeling, unlike that of the vesicular glutamate transporter VGLUT1, was enriched in preterminal axons and present in postsynaptic dendritic spines. Immunoisolation of synaptic vesicles indicated presence of VNUT in a subset of VGLUT1-containing vesicles. Thus, we conclude that VNUT mediates transport of ATP into synaptic vesicles of hippocampal neurons, thereby conferring a purinergic phenotype to these cells. following primers were used: VNUT, TGTGGTAGGCGTGTGTCTAG (forward), AGGTTGCTGACGATGGCCAC (reverse). Reconstitution and ATP Transport Reconstitution of purified mVNUT was carried out by the freeze--thaw method as described previously (Sawada et al. 2008). In brief, 10 lg mVNUT was mixed with liposomes (0.5 (...truncated)